To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® MYA-4941™)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: EBY100  /  Product Format: frozen

Permits and Restrictions

View Permits

Verified By Whole-genome Sequencing
Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomyces
Strain Designations EBY100
Alternate State Candida robusta Diddens et Lodder
Application These cells are used in the yeast display method to isolate novel proteins based on various biological functions.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Genotype MATa AGA1::GAL1-AGA1::URA3 ura3-52 trp1 leu2-delta200 his3-delta200 pep4::HIS3 prbd1.6R can1 GAL
Preceptrol® no
Comments EBY100 (Leu-, Trp-) is BJ5465 and is MATa. It has auxotrophic: ura3-52 (a Ty element insertion with no detectable background reversion frequency), trp1 (an amber point mutation), leu2-delta200, his3-delta200, pep4HIS3, prbd1.6R, can1, GAL. EBY100 has genomic insertion of AGA1 regulated by GAL promoter with a URA3 selectable marker.
Morphology Colonies on YEPD at 30°C after 4 days are butyrous, cream colored, smooth surface and usually flat. Cells are globose, ovoidal or elongate and are usually isolated or in small groups.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC
Morphology Colonies on YEPD at 30°C after 4 days are butyrous, cream colored, smooth surface and usually flat. Cells are globose, ovoidal or elongate and are usually isolated or in small groups.
Name of Depositor KD Wittrup
Chain of Custody ATCC <-- KD Wittrup
Isolation Parent strain used Saccharoymes cerevisiae BJ5465.
Cross References

Nucleotide (GenBank) : KU729069 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729152 D1/D2 region of 26S rRNA gene

References

Boder ET, Wittrup KD. Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15: 553-557, 1997 PubMed: 9181578

Chen P, et al. Evaluation of immune protective efficacies of Eimeria tenella EtMic1 polypeptides with different domain recombination displayed on yeast surface. Exp. Parasitol. 155: 1-7, 2015. PubMed: 25956946

Zhou H, et al. Secretory expression and characterization of an acidic endo-polygalacturonase gene from Aspergillus niger SC323 in Saccharomyces cerevisiae. J. Microbiol. Biotechnol. 25: 999-1006, 2015. PubMed: 25737122

Geiser E, et al. Identification of an endo-1,4-beta-xylanase of Ustilago maydis. BMC Biotechnol. 13: 59, 2013. PubMed: 23889751

Blazic M, et al. Yeast surface display for the expression, purification and characterization of wild-type and B11 mutant glucose oxidases. Protein Expr Purif. 89: 175-180, 2013. PubMed: 23562736

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS
FAQs
  1. Accessing genome sequencing data


    Date Updated: 9/30/2019

  2. Criteria for reference quality genomes


    Date Updated: 9/30/2019