Trichoderma virens (Miller et al.) von Arx, anamorph (ATCC® MYA-4894)

Alternate State: Hypocrea virens Chaverri et al., teleomorph  /  Strain Designations: FGSC 10586 [Tv29-8, Gv29-8]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations FGSC 10586 [Tv29-8, Gv29-8]
Alternate State Hypocrea virens Chaverri et al., teleomorph
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
mycoparasite
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On PDA medium at 25°C after 9 days, colonies dark green covered in a dense layer of white cottony mycelium. Reverse tan to yellow brown. Hyphae hyaline, guttulate. Conidiophores branched.  Phialides in whorls of 3-4, ovoid, 10.5-12 X 4.5 µm. Conidia dark green in mass, pale green singly, globose to subglobose, 3-4.5 X 3-4.5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174053:

AGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174042:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTCGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCGCGTCTAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGA

Morphology On PDA medium at 25°C after 9 days, colonies dark green covered in a dense layer of white cottony mycelium. Reverse tan to yellow brown. Hyphae hyaline, guttulate. Conidiophores branched.  Phialides in whorls of 3-4, ovoid, 10.5-12 X 4.5 µm. Conidia dark green in mass, pale green singly, globose to subglobose, 3-4.5 X 3-4.5 µm.
Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : JX174053 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174042 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : ABDF00000000 Trichoderma virens Gv29-8, whole genome shotgun sequencing project

References

Kubicek CP, et al. Comparative genome sequence analysis underscores mycoparasitism as the ancestral life style of Trichoderma. Genome Biol. 12: R40, 2011. PubMed: 21501500

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation