Phytophthora riparia Reeser et al. (ATCC® MYA-4882)

Strain Designations: VI 3-100B9F [CBS 132024]  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Peronosporaceae, Phytophthora, riparia
Strain Designations VI 3-100B9F [CBS 132024]
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Comments
Plant pathogen
Morphology After 5 days on V8 juice medium at 20°C colonies are angular and petaloid with hyphae appressed. After 3 weeks no sporangia was observed.  Oogonia absent.
Sequenced Data
GenBank accession number: JQ745262

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTATCAACCCCTATAATTTGGGGGCTTGCTCGGCGGCGTGCGTGCTGGCCTGTAATGGGTCGGCGTGCTGCTGCTGGGCGGGCTCTATCATGGGCGAGCGCTTGGGCTTCGGCTCGAGCTAGTAGCTTTCCTTTTAAACCCATTCTTTAAATACTGAACATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCTGGCGGTCTTTCGAGTCTGCCGGTGAGTCCTTTGAAATGTACTGAACTGTACTCTCTCTTTGCTCCAAAAGCGTGGCGTTGCTGGTTGTGGAGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTTAGCTGTGGCGTTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAATCTGCTTATTGGGTGCTTTTCCTGCTGCAGCGGTATGAACTGGTGAACCGTAGCTGTGTGGTGCTTGGCTTTTGAACCGGCTTTGCTTTGCGAAGTAGGGTGGCGGCTTCGGCTGTCGAGGGGTCGATCCATTTTGGGAAAGTTTGTGTGTGCGGCTTCGTGCTGCGCGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG

GenBank accession number: JQ745269

Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGCGCTGTGGCAGTGGCTTTTTTGGCTGCGCTCGGTGCGTGTGTTGTGCGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 5 days on V8 juice medium at 20°C colonies are angular and petaloid with hyphae appressed. After 3 weeks no sporangia was observed.  Oogonia absent.
Name of Depositor E Hansen
Special Collection ATCC
Chain of Custody
ATCC <-- E Hansen <-- P Remigi
Isolation
Forest streams, Oak Creek, Oregon, USA
Cross References

Nucleotide (GenBank) : JQ745262 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ745269 D1/D2 region of the 28S rRNA gene.

References

Hansen EM, et al. Phytophthora borealis and Phytophthora riparia, new species in Phytophthora ITS clade 6. Mycologia 104: 1133-1142. PubMed: 22778166

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation