Search

Wickerhamomyces anomalus (Hansen) Kurtzman et al. (ATCC® 96603™)

Strain Designations: UCSC 25F [VP25F]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Pichia anomala (Hansen) Kurtzman
Strain Designations UCSC 25F [VP25F]
Application
Produces killer toxin
Produces killer toxin in experimentally infected animals
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

AAGGATCATTATAGTATTCTATTGCCAGCGCTTAATTGCGCGGCGATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTTGCTTTGGGTGGTGAGCCTGGCTTACTGCCCAAAGGTCTAAACACATTTTTTTTAATGTTAAAACCTTTAACCAATAGTCATGAAAATTTTTAACAAAAATTAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTGTCAAGGGTTAACTTGAAATATTGACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAATAATGTATTAGGTTCTTCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAGTATTTTAGGCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCG
Name of Depositor L Polonelli
Special Collection NCRR Contract
Chain of Custody ATCC <-- L Polonelli <-- F. Fanti VP25F
Isolation
Paste, Parma, Italy
References

Polonelli L, Morace G. Reevaluation of the yeast killer phenomenon. J. Clin. Microbiol. 24: 866-869, 1986. PubMed: 3771773

Polonelli L, Morace G. Production and characterization of yeast killer toxin monoclonal antibodies. J. Clin. Microbiol. 25: 460-462, 1987. PubMed: 2434524

Polonelli L, Morace G. Yeast killer toxin-like anti-idiotypic antibodies. J. Clin. Microbiol. 26: 602-604, 1988. PubMed: 2451680

Polonelli L, et al. Production of yeast killer toxin in experimentally infected animals. Mycopathologia 110: 169-175, 1990. PubMed: 2201918

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS