To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X

Aspergillus pachycristatus Matsuzawa et al. (ATCC® 58397)

Strain Designations: NRRL 11440 [A42355]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Aspergillus nidulans var. roseus Boeck et Kastner
Classification Fungi, Dikarya, Ascomycota, Pezizomycotina, Eurotiomycetes, Eurotiomycetidae, Eurotiales, Aspergillaceae, Aspergillus
Strain Designations NRRL 11440 [A42355]
Application
produces A30912
produces echinocandin B
produces sterigmatocystin
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments This fungus was re-identified as Aspergillus pachycristatus based on the multigene sequence analysis
Morphology After 6 days on Potato dextrose medium at 25°C, colony velutinous, buff and green, reverse red-orange. Conidiophores with short stipes, vesicles globose, biseriate, with phialides only on the upper half of the vesicles. Conidia green, subglobose, smooth-walled. Ascospores red, lenticular, with flanges. Globose Hülle cells abundant.
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCAGGGTGCCCGTGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGGCCCCGGGGTTCAGCCAGCACTCGTGCTGGTGTACTTCCCCGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCAGGAATGTATCGCCCTCCGGGGTTGTCTTATAGCCTGGGGTGCAATGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCGTAATGGTCGCAAACGAC


Calmodulin gene

GTTTGTAAGTGCCATTGGTTATTGTTATATCAAATTCGAATTTATATTGAGAGTATACTAATTTATTCCGCGCTTAACAGGACAAGGATGGCGATGGTTAGTGCATTTGTCCCCCCAGACCTGATCGCATTCGCCCAGCGTGTCTGCTGTAGTTCTATATAAACCGATTCTGATAAACGGCGACAGGCCAGATTACCACTAAGGAGCTTGGCACTGTCATGCGCTCGCTCGGTCAGAATCCTTCAGAGTCTGAACTTCAGGACATGATCAACGAAGTTGACGCCGACAACAATGGCACCATCGACTTCCCAGGTACGCGATCTCCCGATCTACTTCTCAGCAAGCTAGAAACTGTACTAATGATAAACAGAGTTCCTTA


18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCCCCCCAGGGGCGAGCCGCCGGGGACCACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGCCTGAATACAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGATTAGGGCCGGCCGGGCGCCAGCCGGCGTCTCCAACCTTATTTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Morphology After 6 days on Potato dextrose medium at 25°C, colony velutinous, buff and green, reverse red-orange. Conidiophores with short stipes, vesicles globose, biseriate, with phialides only on the upper half of the vesicles. Conidia green, subglobose, smooth-walled. Ascospores red, lenticular, with flanges. Globose Hülle cells abundant.
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- Eli Lilly & Co. A42355
Isolation
Soil, Indiana, USA
References

Boeck LD, Kastner RE. Method of producing the A-30912 antibiotics. US Patent 4,288,549 dated Sep 8 1981

Branch KR, Bennett JW, Bhatnagar D. Sterigmatocystin production by Aspergillus nidulans. Fungal Genet Newsl 40: 20-21, 1993.

Hodges RL, et al. Genetic modification of an echinocandin B-producing strain of Aspergillus nidulans to produce mutants blocked in sterigmatocystin biosynthesis. J. Ind. Microbiol. 13: 372-381, 1994. PubMed: 7765669

Tóth V, et al. The echinocandin B producer fungus Aspergillus nidulans var. roseus ATCC 58397 does not possess innate resistance against its lipopeptide antimycotic. Appl. Microbiol. Biotechnol., in press, 2012. PubMed: 22555909

Cacho RA, et al. Identification and characterization of the echinocandin B biosynthetic gene cluster from Emericella rugulosa NRRL 11440. J Am Chem Soc 134: 16781-16790, 2012. PubMed: 22998630

Toth V, et al. Polyphasic characterization of "Aspergillus nidulans var. roseus" ATCC 58397. Folia Microbiol 56: 381-388, 2011. PubMed: 21858538

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation