To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X

Epidermophyton floccosum (Harz) Langeron et Milochevitch (ATCC® 52066)

Strain Designations: ES 3115  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations ES 3115
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Taxonomy
Produces macroconidia
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGCAGTCGGCCCGTCCCCCTTCTCTCTGAATGCTGGACGGTGTCGCCGGCCACACGCCCATTCTTGTCTACACTACCCGGTTGCCTCGGCGGGCCGCGCCCCCTAGGCTGCAGTGTCGCTGCAGCGTCTCGGGGGGGCCGTTCGGGGGATGGAGAAGGATGCCCCGGCGGGGTTGATCGCTCCCCCACCCCTGGACAGCGCTCGCCGAAGGAGTGATTCTCAGAAATTCTACGAAATCTCCATAGGTGGTTCAGTCTGAGCGTTGGCAAGCAAAAACCAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGACCGCCTTTGCATCCCCCGTTCCACCGGGAGAGGAGAAAGGTGGAGGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGGCCCCTGGGCGAATGGGCAACAAAACCAGCGCCTTCAGGACCGGCCGGCTCTCTGGCCCTAGTTTCCGTCGGGAGGACGAAAGGGGGCGACCCCTCTCTCCCCTCCGCATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCTCCGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGCGCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGGCGGGGTTCAGCGGGCGCTCGTCGCCCGTGCACTCCCCGCGTTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGTCGTAAGCGGC


Calmodulin gene

GTAAGTCATATCTGCTAGCCCTTGTTGTGTCTAGAGTGATATCGTTCAAGGATGCCCCGCCCTTGAAGCGTGTAGACAGGTAGCTGACCGAGTATTCCACCATCGAACAGGATAAAGATGGCGATGGTGAGTAGCGATTTCTGCCTGCAAAGAAACCGAGACTATAGTCCAGTAGGCCTGAAAAGAGTGTCGACTGATATGCCTCATCCAATAGGCCAAATTACAACCAAGGAGTTGGGAACAGTGATGCGATCCCTGGGCCAGAACCCTTCCGAATCCGAGCTACAAGACATGATTAACGAGGTTGATGCCGACAACAATGGAACTATCGATTTCCCAGGTACGATCTGCACCTGGGAATCACACCCCATCCACCCGTTTTCCAACAAGCCTCAGGCGTGAAGATACCCATGGCACAAAGAAAGGCAAAGAAAAGGTTACGCTAATCGCTTAAATGGTACAGAGTTCTTGA

Name of Depositor WC Noble
Cross References

Nucleotide (GenBank) : AF152234 Epidermophyton floccosum actin (ACT) gene, partial cds.

References

Jones MG, Noble WC. A study of fatty acids as a taxonomic tool for dermatophyte fungi. J. Appl. Bacteriol. 50: 577-583, 1981. PubMed: 7251521

Jones MG, Noble WC. An electrophoretic study of enzymes as a tool in the taxonomy of the dermatophytes. J. Gen. Microbiol. 128: 1101-1107, 1982. PubMed: 7108488

Okeke CN, et al. Isolation of an intron-containing partial sequence of the gene encoding dermatophyte actin (ACT) and detection of a fragment of the transcript by reverse transcription-nested PCR as a means of assessing the viability of dermatophytes in skin scales. J. Clin. Microbiol. 39: 101-106, 2001. PubMed: 11136756

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation