To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Microsporum audouinii Gruby (ATCC® 42558™)

Strain Designations: ET 384  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Fungi, Dikarya, Ascomycota, Pezizomycotina, Eurotiomycetes, Eurotiomycetidae, Onygenales, Arthrodermataceae, Microsporum
Strain Designations ET 384
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Tinea capitis
Morphology After 7-10 days colonies velutinous, tannish-white; reverse rose-brown. Later, macroconidia smooth-walled to sparsely echinulate, thick-walled, irregularly spindle-shaped, of variable size and cell number, mostly with slightly bent, verrucose apex. Microconidia not observed
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCCTCCGGCCGCACGCCCATTCTTGTCTACTGACCCGGTTGCCTCGGCGGGCCGCGCCTGCTGTGCTACAGCGGCCGTTCGGGGGGGACGCCTGAGGGGGACTTTTGTTTCCTAGGCCACGCCCCGGGCAGCGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCGAGCAACGCAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCCCCCCAATAACCACCCACCGCTTAGGGGGGTGGGAGGGAGGGGGACGCGCCCGAAAAGCAGTGGTCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGACATACCACCGCCTCTAGGACCGGCCGGTAGGCTGGCCTAACGCACCATGTATTATTCAGGTTGACCTCGGATCAGGTAGGGATACCC


D1D2 region of the 28 ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCTTGGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGAGGGGCGGGGTTCAGCGGGTGCGCGTCACCCGTGCACTCCCCGTCCCCTCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGCCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGG
Morphology After 7-10 days colonies velutinous, tannish-white; reverse rose-brown. Later, macroconidia smooth-walled to sparsely echinulate, thick-walled, irregularly spindle-shaped, of variable size and cell number, mostly with slightly bent, verrucose apex. Microconidia not observed
Name of Depositor YM Clayton
Isolation
Scalp hair of child
References

Clayton, YM. The changing pattern of tinea capitis in London school children. Mykosen (Suppl.) 1: 104-107, 1978.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS