Zygosaccharomyces rouxii (Boutroux) Yarrow (ATCC® 2623)

Alternate State: Candida mogii Vidal-Leiria, Candida placentae Goto  /  Strain Designations: NRRL Y-229 [ATCC 56077, CBS 732, CCRC 21506, DBVPG 6187, IFO 1130, MUCL 30254, NCYC 568]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Zygosaccharomyces rouxii
Strain Designations NRRL Y-229 [ATCC 56077, CBS 732, CCRC 21506, DBVPG 6187, IFO 1130, MUCL 30254, NCYC 568]
Alternate State Candida mogii Vidal-Leiria, Candida placentae Goto
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Genolevures Consortium, France).
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAATGACGTGAACTCTTAACGGAGTTCTCTCAAAGTGTTGGAGGGGAAGGCCTGCGCTTAATTGCGCGGCTGTTTTTAATCTCCTCCGCCTTTGATACACACATTGGAGTTTCTACTTTTTTGTTCTCTTTGGGAGGGTTCTGCTCTCCCAGAGGTAAACACAAACAATCTTTTATTATACTATTAACACAGTCAAATGAATTTTAAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAACTGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACTTTACGTTTGGTAGTGAGCGATACTCTACTCTGGAGTTTGCTTGAAAATGGGAGGCCATAGGCGAAGCATTGCTTTCCAATCCTGCGGCCCTCTGCTTACTTCCCCTTGTGGGTTGTGGCAGGGGAAAGCGGGAGGCGCCTTGCCACGATAGTCGTATTAGGTTTTACCGACTCGGCGAAAGTGAAGAGGTTTGCTTTTTAAAAAGAAGCAGGCAGCGTCTGGCTTGACAAAATTCTCAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAAAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGGACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCTCTGGGAATGTGGCTTCTTTCTTCGGGAGGGAGTGTTATAGCCCAGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC

Name of Depositor NRRL
Isolation
Grape must, Italy
Cross References

Nucleotide (GenBank) : AJ133372 nucleotide sequence of ADE3 gene

References

Toh-e A, et al. 2-micrometers DNA-like plasmids in the osmophilic haploid yeast Saccharomyces rouxii. J. Bacteriol. 151: 1380-1390, 1982. PubMed: 6286598

Sychrova H, et al. Molecular cloning and sequence analysis of Zygosaccharomyces rouxii ADE2 gene encoding a phosphoribosyl-aminoimidazole carboxylase. Yeast 15: 1399-1402, 1999. PubMed: 10509021

Torok T, Reichart O. Thermal inactivation kinetics of sugar-tolerant yeasts. Eur. J. Appl. Microbiol. Biotechnol. 17: 191-196, 1983.

Oshio K, et al. Construction of a host-vector system in the osmophilic haploid yeast Zygosaccharomyces rouxii. J. Ferment. Technol. 66: 481-488, 1988.

Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.

de Montigny J, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 8. Zygosaccharomyces rouxii. FEBS Lett. 487: 52-55, 2000.

Kurtzman CP, Robnett CJ. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species. FEMS Yeast Res. 13: 23-33, 2013. PubMed: 22978764

Souciet JL, et al. Comparative genomics of protoploid Saccharomycetaceae. Genome Res 19: 1696-1709, 2009. PubMed: 19525356

Rosenblad MA, et al. Kinship in the SRP RNA family. RNA Biol. 6: 508-516, 2009. PubMed: 19838050

Gordon JL, Wolfe KH. Recent allopolyploid origin of Zygosaccharomyces rouxii strain ATCC 42981. Yeast 25: 449-456, 2008. PubMed: 18509846

Suezawa Y, Suzuki M, Mori H. Genotyping of a miso and soy sauce fermentation yeast, Zygosaccharomyces rouxii, based on sequence analysis of the partial 26S ribosomal RNA gene and two internal transcribed spacers. Biosci. Biotechnol. Biochem. 72: 2452-2455, 2008. PubMed: 18776675

Pribylova L, et al. Characterisation of Zygosaccharomyces rouxii centromeres and construction of first Z. rouxii centromeric vectors. Chromosome Res 15: 439-445, 2007. PubMed: 17487563

Andersen ES, et al. The tmRDB and SRPDB resources. Nucleic Acids Res. 34: D163-D168, 2006. PubMed: 16381838

James SA, et al. Molecular evidence for the existence of natural hybrids in the genus Zygosaccharomyces. FEMS Yeast Res. 5: 747-755, 2005. PubMed: 15851103

Neves L, Oliveira R, Lucas C. Yeast orthologues associated with glycerol transport and metabolism. FEMS Yeast Res. 5: 51-62, 2004. PubMed: 15381122

Van Nues RW, Brown JD. Saccharomyces SRP RNA secondary structures: a conserved S-domain and extended Alu-domain. RNA 10: 75-89, 2004. PubMed: 14681587

Butler G, et al. Evolution of the MAT locus and its Ho endonuclease in yeast species. Proc. Natl Acad. Sci. USA 101: 1632-1637, 2004. PubMed: 14745027

Kurtzman CP, Robnett CJ. Phylogenetic relationships among yeasts of the 'Saccharomyces complex' determined from multigene sequence analyses. FEMS Yeast Res 3: 417-432, 2003. PubMed: 12748053

Li X, et al.. Phylogenetic analysis of the structure of RNase MRP RNA in yeasts. RNA 8: 740-751, 2002. PubMed: 12088147

Kinclova O, Potier S, Sychrova H. The Zygosaccharomyces rouxii strain CBS732 contains only one copy of the HOG1 and the SOD2 genes. J Biotechnol 88: 151-158, 2001. PubMed: 11403849

Sychrova H, Braun V, Souciet JL. Sequence and organization analyses of a Zygosaccharomyces rouxii DNA fragment containing the HIS3 gene. Yeast 16: 581-587, 2000. PubMed: 10806420

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation