To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Aspergillus parasiticus Speare (ATCC® 15517)

Strain Designations: M001 [CBS 260.67, DSM 2038, IFO 30179, IMI 120920, TPI]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Aspergillus flavus Link
Strain Designations M001 [CBS 260.67, DSM 2038, IFO 30179, IMI 120920, TPI]
Application
Produces 4,4'-dihydroxybiphenyl
Produces aflatoxin B1 aflatoxin B
Produces aflatoxin B2
Produces aflatoxin G1
Produces aflatoxin G2
Produces aflatoxins
Produces versiconal acetate
Transforms sesquiterpene lactone costunolide
Converts averufin into aflatoxins
Converts (14C) sterigmatocystin into aflatoxin B1
Challenge organism for testing inhibition of mycotoxin production with dialkyl enol phosphate
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Aspergillus parasiticus var. globosus)
Preceptrol® no
Comments
Rat colon carcinomas
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGCGTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAAACAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGA


Calmodulin gene, partial sequence

GTTTATCAAGTTTCTGTTCGATCGGCTGAAGTCTTGGCATTGATGAATTGACTTGATATGCAGGCCAGATCACCACCAAGGAGTTGGGCACTGTCATGCGCTCTCTGGGTCAAAACCCCTCTGAGTCGGAACTCCAGGACATGATTAACGAGGTTGACGCCGACAACAATGGCACCATTGACTTCCCTGGTACGAGACGGCTTCGTACGATTCATAAATGAAATAGTTGTTAATCGTCCAAATAGAATTCCTTACCATGATGGCC

Name of Depositor RI Mateles
Chain of Custody
ATCC <-- RI Mateles <-- Tropical Products Inst. strain TPI
References

Reddy TV, et al. Factors affecting aflatoxin production by Aspergillus parasiticus in a chemically defined medium. J. Gen. Microbiol. 114: 409-413, 1979. PubMed: 541661

Golbeck JH, Cox JC. The hydroxylation of biphenyl by Aspergillus toxicarius: conditions for a bench scale fermentation process. Biotechnol. Bioeng. 26: 434-441, 1984.

Leary JS. Methods of controlling mycotoxin production using certain dialkyl enol phosphates. US Patent 3,798,323 dated Mar 19 1974

. . J. Gen. Appl. Microbiol. 12: 195, 1966.

Newberne PM, Rogers AE. Rat colon carcinomas associated with aflatoxin and marginal vitamin A. J. Natl. Cancer Inst. 50: 439-448, 1973. PubMed: 4702116

Clark AM, Hufford CD. Microbial transformations of the sesquiterpene lactone costunolide. J. Chem. Soc. Perkin Trans. 1979: 3022-3028, 1979.

Steyn PS, et al. Structure and carbon-13 nuclear magnetic resonance assignments of versiconal acetate, versiconol acetate, and versiconol, metabolites from cultures of Aspergillus parasiticus treated with dichlorvos. J. Chem. Soc. Perkin Trans. 1979: 451-459, 1979.

Steyn PS, et al. Biosynthesis of versiconal acetate, versiconol acetate, and versiconol, metabolites from cultures of Aspergillus parasiticus treated with dichlorvos. The role of versiconal acetate in aflatoxin biosynthesis. J. Chem. Soc. Perkin Trans. 1979: 460-463, 1979.

Wei DL, Jong SC. Production of aflatoxins by strains of the Aspergillus flavus group maintained in ATCC. Mycopathologia 93: 19-24, 1986. PubMed: 3083260

Adye J, Mateles RI. Incorporation of labelled compounds into aflatoxins. Biochim. Biophys. Acta 86: 418-420, 1964.

Lin MT, et al. Conversion of averufin into aflatoxins by Aspergillus parasiticus. Biochemistry 12: 5167-5171, 1973. PubMed: 4792300

Singh R, Hsieh DP. Enzymatic conversion of sterigmatocystin into aflatoxin B1 by cell-free extracts of Aspergillus parasiticus. Appl. Environ. Microbiol. 31: 743-745, 1976. PubMed: 5954

type strain of Aspergillus parasiticus var. globosus

type strain of Aspergillus parasiticus var. globosus

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation