Aspergillus nidulans (Eidam) Winter, anamorph (ATCC® 38163)

Alternate State: Emericella nidulans (Eidam) Vuillemin, teleomorph  /  Strain Designations: G00 [ATCC 12996, ATCC 26451, C. Thom 5616.1, CBS 112.46, FGSC A4, Glasgow wild-type, Pontecorvo strain, IMI 38576ii, NRRL 194, SRRC 273, WB 194, Yuill A69, biA-1]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations G00 [ATCC 12996, ATCC 26451, C. Thom 5616.1, CBS 112.46, FGSC A4, Glasgow wild-type, Pontecorvo strain, IMI 38576ii, NRRL 194, SRRC 273, WB 194, Yuill A69, biA-1]
Alternate State Emericella nidulans (Eidam) Vuillemin, teleomorph
Application
Produces ferricrocin
Produces triacetylfusigen
Transformation host
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype argB
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Biotin-dependent as standard wild type for most purposes
Genome sequencing strain (Broad Institute, USA).
Morphology On PDA medium at 25°C after 6 days, mycelium buff to cinnamon brown becoming army green as conidia develop, velutinous. Reverse tan to reddish brown becoming dark reddish brown. Hyphae hyaline with some stained dark red, guttulate. Conidia globose to subglobose, green, roughened, 4.5-6 X 4.5 µm.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CCTGCGGAAGGATCATTACCGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCCCCCCAGGGGCGAGCCGCCGGGGACCACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGCCTGAATACAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGATTAGGGCCGGCCGGGCGCCAGCCGGCGTCTCCAACCTTATTTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCAGGGTGCCCGTGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGGCCCCGGGGTTCAGCCAGCACTCGTGCTGGTGTACTTCCCCGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCAGGAATGTATCGCCCTCCGGGGTTGTCTTATAGCCTGGGGTGCAATGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCGTAATGGTCGCAAAC

Morphology On PDA medium at 25°C after 6 days, mycelium buff to cinnamon brown becoming army green as conidia develop, velutinous. Reverse tan to reddish brown becoming dark reddish brown. Hyphae hyaline with some stained dark red, guttulate. Conidia globose to subglobose, green, roughened, 4.5-6 X 4.5 µm.
Name of Depositor AJ Clutterbuck
Cross References

Complete Genome (GenBank) : AACD00000000 Aspergillus nidulans FGSC A4, whole genome shotgun sequencing project

References

Charlang G, et al. Cellular and extracellular siderophores of Aspergillus nidulans and Penicillium chrysogenum. Mol. Cell. Biol. 1: 94-100, 1981. PubMed: 6242827

Pontecorvo G, et al. The genetics of Aspergillus nidulans. Adv. Genet. 5: 142-238, 1953.

Zonneveld BJ. Inhibitory effect of 2-Deoxyglucose on cell wall alpha-1,3-glucan synthesis and cleistothecium development in Aspergillus nidulans. Dev. Biol. 34: 1-8, 1973. PubMed: 4595497

Dorn GL. A revised map of the eight linkage groups of Aspergillus nidulans. Genetics 56: 619-631, 1967. PubMed: 6061654

Lin WL, et al. Kinetics of cell growth and heterologous glucoamylase production in recombinant Aspergillus nidulans. Biotechnol. Bioeng. 41: 273-279, 1993.

Timberlake WE. Low repetitive DNA content in Aspergillus nidulans. Science 202: 973-975, 1978. PubMed: 362530

Yadwad VB, et al. Effect of culture conditions and induction strategies on production of human interleukin-6 by a recombinant Aspergillus nidulans strain. Mycol. Res. 100: 356-360, 1996.

Galagan JE, et al. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438: 1105-1115, 2005. PubMed: 16372000

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation