Fusarium solani (Martius) Saccardo, anamorph (ATCC® MYA-3636)

Alternate State: Nectria haematococca Berkeley et Broome, teleomorph  /  Strain Designations: FS1  /  Product Format: frozen

Strain Designations FS1
Alternate State Nectria haematococca Berkeley et Broome, teleomorph
Application
Antifungal susceptibility testing RefGhannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. RefEspinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology Colonies growing rapidly forming white aerial mycelium, green to bluish-brown when sporodochia are present; reverse usually colorless. Monophialides with a rather distinct collarette. Macroconidia usually moderately curved, with short, blunt apical and indistinctly pedicellate basal cells, mostly 3-septate, 28-42 × 4-6 µm. Microconidia usually abundant, 8-16 × 2.0-4.5 µm. Chlamydospores common.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATTCGAGGTCAACATTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGCCGCTCTCCAGTTGCGAGGTGTTAGCTACTACGCAATGGAAGCTGCGGCGGGACCGCCACTGTATTTGGGGGACGGCGTTGTGCCCGCAGGGGGCTTCCGCCGATCCCCAACGCCAGGCCCGGGGGCCTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTGTTTACTCAGAAGAAACATTATAGAAACAGAGTTAGGGGGTCCTCTGGCGGGGGCGGCCCGTGTTACGGGGCCGTCTGTTCCCGCCGAGGCAACGTTATAGGTATGTCACAGGGGGATGA
Morphology Colonies growing rapidly forming white aerial mycelium, green to bluish-brown when sporodochia are present; reverse usually colorless. Monophialides with a rather distinct collarette. Macroconidia usually moderately curved, with short, blunt apical and indistinctly pedicellate basal cells, mostly 3-septate, 28-42 × 4-6 µm. Microconidia usually abundant, 8-16 × 2.0-4.5 µm. Chlamydospores common.
Name of Depositor TJ Walsh
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- TJ Walsh
Isolation
human
References

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.

Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.