Dictyostelium unicornutum Cavender et al. (ATCC® MYA-4861)

Strain Designations: OH599  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Dictyosteliales
Strain Designations OH599
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Genotype Not available
Preceptrol® no
Comments Grown in two-member culture with Escherichia coli (ATCC 23437)
Morphology On LY agar after 10 days at 20°C, Sorocarps solitary to loosely clustered and erect.
Sequenced Data
18S ribosomal RNA gene, partial sequence:

GAAACTGCAGACGGCTCATTACAACAGTGATAAACTAATAGAGTTTCGGGTCTAACCTTTATGGATATCCGCAGTAAATCGGGGCTAATACATACAAACGAGGGGTGACTGTTTACAGAAGCTTCGCGATTATTAGTCTAACCAATACCCGCAAGGGTCTAGTGGTGAAACCGAATAATATTGCAGATCGAAACCTAGTTTCGACGATTCTATTGTGTCACTGCCCTATCAACTTTCGATGGTACGGTATTGGCCTACCATGGTTGTAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGCGCCTGAGAAATGGCGACCACTTCTACGGAAGGCAGCAGGCGCGCAAATTACTCAATCCCAATACGGGGAAGTAGTGACAATAAATATCAATGCCTATTCGTTTTTCGAAAGGTAATTGAAATGGGTACAAATTAAACCCCTTAACCAATACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATATACTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGAAACTAAATTTGTATTGGGCTCAAGCTTGTAGCCACTTTGGTGGTTATCAAGTTCCAGTGCATTTTTTTGAAGCGGCCCTTAAAGCCTCTACCTCGTAGTTGGTTTTCTTGGGTTTTTCACTGTGAGAAAATTGTGGTGTTCAAAGCGGGCGTTTCGCCTGATCTTTTGCAGCATGGGATGATAAAACATGACATTCAATGCAATTGGTTGCATCTGAGTGTAATGATTAATAGGGATGGATGGGGGTGTTCATATTGGTGGGCGAGAGGTGAAATTCGTTGACCCTATCAAGATGAACTTCTGCGAAAGCATTCATCAAATACTTCCCCATTAATCAAGAACGAAAGTTTGGGGATCAAAGACGATCAGATACCGTCGTAGTCCAAACTATAAACTATGTCGACCAGGGATCGGGTAGCATTTTTCAAAAATCTATTTGGCACCTTGTGAGAAATCATGAGTGTTTAGATTCTGGGGGGAGTATGGTCGCAAGTCTGAAACTTAAAGGAATTGACGGAAGGGCACACAATGGAGTGGAGCCTGCGGCTTAATTTGACTCAACTCGGGAAAACTTACCAAGCTAAGATATAGTAAGGATTGACAGACTAAAAGATTTTTCATGATTCTATAAGTGGTGGTGCATGGTCGTTCTTAGTTGGTGGAGCAATCTGTCTGGTCAATTCCGATAACGGACGAGATCTCGACCTGCTAACTAGTAGTACGTATTTGGTCGATATGGGTGAAGGCTCTTTTGGAGTAAGTTGTGCGTCGCAAGGTGTACAGCACTTCTGGGGGTTTGTAACCTGGTCAGATACGTACGATTAAAAAAACTTCTTAGAGGGACTACCTGTGGCAAACAGGGGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCTTAGATACCTTGGGCCGCACGCGCGCTACAATGTAAAAGGCAAAAAGCTTTCCTGGTCCGGAAGGACTGGGTAATCATCTGAATTTTTTACGTAACTGGGATTGATCTTTGTAATTATTGATCATCAACGAGGAATTCCTTGTAAGCGCAAATCATTACTTTGTGCTGAATAGGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATCGAATGATACGGTAAAGCCAACAGATATGGCTCTGTAGCAATACGAGAGTTGTAGAAGT

Morphology On LY agar after 10 days at 20°C, Sorocarps solitary to loosely clustered and erect.
Name of Depositor J.C. Landolt
Chain of Custody ATCC <-- J.C. Landolt; Shepherd University <-- J.C. Cavender
Isolation Soils collected from the semi-green rain forest of Tikal, Guatemala.
References

Cavender JC, et al. Ten new small dictyostelids from seasonal rain forests of Central America. Mycologica 105(3): 610-635, 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation