Rhodotorula graminis di Menna (ATCC® MYA-4893)

Strain Designations: FGSC 10291 [WP1]  /  Product Format: frozen

Strain Designations FGSC 10291 [WP1]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On YM medium at 25°C after 9 days, colonies orange to reddish orange with very thin white margin, smooth, mucoid. Cells ovoid to ellipsoidal, smooth, 4.5-6.75 X 3-4.5µm. Pseudohyphae not observed.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174052:

AAGGATCATTAGTGAATCTAGGACGTCCAACTTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCATCTGTTAAATTGGACTAGTAGCTCTTCGGAGTGAACCGCCATTCACTTATAAACACAAAGTCTATGAATGTATACAAATTTATAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCCACCTCTTTCTTAGTGAATCTGGTGGTGCTTGGTTTCTGAGCGCTGCTCTGCTTCGGCTTAGCTCGTTCGTAATGCATTAGCATCCGCAACCGAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGATTCTAGTTTTACTAGAGCCGAGTTGGGTTAAAGGAAGCTCCTAATCCTAAAGTCTATTTTTTGATTAGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174041:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAAACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACACTTTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGGAGCTTGCTTCGGTTTGCAGGCCAGCATCAGTTTTCCGGGGTGGATAATGACGGTTTGAAGGTAGCAGTCTCGGCTGTGTTATAGCTTTCCGTTGGATACATCCTGGGGGACTGAGGAACGCAGCGTGCTTTTTGCGAAAGACTCGTCTTTTTCACGCTTAGGATGCTGGTGGAATGGCTTTAAACGA
Morphology On YM medium at 25°C after 9 days, colonies orange to reddish orange with very thin white margin, smooth, mucoid. Cells ovoid to ellipsoidal, smooth, 4.5-6.75 X 3-4.5µm. Pseudohyphae not observed.
Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Isolation
Stems of wild cottonwood (Populus trichocarpa), Three Forks Park, King County, Washington, USA.
Cross References

Nucleotide (GenBank) : JX174052 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174041 D1/D2 region of 28S rRNA gene

References

Xin G, et al. Characterization of three endophytic, indole-3-acetic acid-producing yeasts occurring in Populus trees. Mycol. Res. 113: 973-980, 2009. PubMed: 19539760