Terfezia boudieri Chatin (ATCC® MYA-4763)

Strain Designations: 27-01  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 27-01
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Desert truffle
Multisporic isolate
ITS type 3
Morphology On PDA medium at 25°C after 20 days, colonies white, cottony, aerial hyphae abundant. Hyphae guttulate, hyphal swellings present, clamps not observed.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 2798: MMNC Medium
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174047:

AAGGATCATTACTGAAAAACTATTTTAAGTTTTTTATATCCCATTGTTTACTTACCCTGTTGCTTTCACTGGACAGATTTCACCTTGTGTGGGTCCTTTGGCTTGTGTGAAATACCACTTGCCAAAGAGTTGCCAGTGGTAAGACCTATTTATCAAAACTTGAGTTTCAATAAACACAACTGTCTGAATATTTTTTTTCTTTAATGAAATAAAACTTTCAACAACGGATCTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATCTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTATGGTATTCCATTGGGCATGCCTGTCTGAGCGTCAGCTCCCCCTCCACTCAAGAATTATTTTATATGATACTTGGATTACTTTGGAGATGTAACTGTATATTAAGTTGCCCTCCAGAAATTCATTGGCAGTATGGTTTGTACTTGGACCAGACGTAATAGTAATAAAATCGTTTGTTTGGGTATAATTGAATTGTACTTGCCTTAACCCCCACCCATTTTTATTTTGGGTGACCTCAGATCAGGTAGGGATACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174036:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAGATTTGAAATCTGGTGTCATTTTGGCATCCGAGTTGTAGTCTGTAGAGGTGTATTCGAGTGTAGCTTTGGCTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTTAACGGCCTTTGTCTTGTGCTCATGTGAATCTCCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCAAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTCTGAACAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGCAACCAGACGCACTTGCAGCCGATCAATTCTCATTTTTGAGGGTGCACTCGGTTGTCTGTGGGTCAGCATCAGTTATGGTGGTAGGAAAAAGACTTAGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCTTTTGTGCAATGCTGCCTGCTGTGACTGAGGACCGCGCTTTGGCGAGGATGCTGGCATAATGGTTGTAAGTGA
Morphology On PDA medium at 25°C after 20 days, colonies white, cottony, aerial hyphae abundant. Hyphae guttulate, hyphal swellings present, clamps not observed.
Name of Depositor Y Sitrit
Special Collection ATCC
Chain of Custody
ATCC <-- Y Sitrit
Isolation
Fruiting body, Negev Desert, Israel.
Geographical Isolation Negev Desert, Israel
Cross References

Nucleotide (GenBank) : JX174036 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JX174047 ITS including 5.8S rRNA gene

References

Awameh MS, Alsheikh A. Ascospore germination of the black kame (Terfezia boudieri). Mycologia 72(1): 50-54, 1980.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation