Terfezia boudieri Chatin (ATCC® MYA-4763)

Strain Designations: 27-01  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 27-01
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
Desert truffle
Multisporic isolate
ITS type 3
Morphology On PDA medium at 25°C after 20 days, colonies white, cottony, aerial hyphae abundant. Hyphae guttulate, hyphal swellings present, clamps not observed.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 2798: MMNC Medium
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174047:

AAGGATCATTACTGAAAAACTATTTTAAGTTTTTTATATCCCATTGTTTACTTACCCTGTTGCTTTCACTGGACAGATTTCACCTTGTGTGGGTCCTTTGGCTTGTGTGAAATACCACTTGCCAAAGAGTTGCCAGTGGTAAGACCTATTTATCAAAACTTGAGTTTCAATAAACACAACTGTCTGAATATTTTTTTTCTTTAATGAAATAAAACTTTCAACAACGGATCTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATCTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTATGGTATTCCATTGGGCATGCCTGTCTGAGCGTCAGCTCCCCCTCCACTCAAGAATTATTTTATATGATACTTGGATTACTTTGGAGATGTAACTGTATATTAAGTTGCCCTCCAGAAATTCATTGGCAGTATGGTTTGTACTTGGACCAGACGTAATAGTAATAAAATCGTTTGTTTGGGTATAATTGAATTGTACTTGCCTTAACCCCCACCCATTTTTATTTTGGGTGACCTCAGATCAGGTAGGGATACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174036:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAGATTTGAAATCTGGTGTCATTTTGGCATCCGAGTTGTAGTCTGTAGAGGTGTATTCGAGTGTAGCTTTGGCTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTTAACGGCCTTTGTCTTGTGCTCATGTGAATCTCCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCAAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTCTGAACAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGCAACCAGACGCACTTGCAGCCGATCAATTCTCATTTTTGAGGGTGCACTCGGTTGTCTGTGGGTCAGCATCAGTTATGGTGGTAGGAAAAAGACTTAGGGAATGTAGCTTCTTTCGGGGAGTGTTATAGCCTTTTGTGCAATGCTGCCTGCTGTGACTGAGGACCGCGCTTTGGCGAGGATGCTGGCATAATGGTTGTAAGTGA
Morphology On PDA medium at 25°C after 20 days, colonies white, cottony, aerial hyphae abundant. Hyphae guttulate, hyphal swellings present, clamps not observed.
Name of Depositor Y Sitrit
Special Collection ATCC
Chain of Custody
ATCC <-- Y Sitrit
Isolation
Fruiting body, Negev Desert, Israel.
Geographical Isolation Negev Desert, Israel
Cross References

Nucleotide (GenBank) : JX174036 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JX174047 ITS including 5.8S rRNA gene

References

Awameh MS, Alsheikh A. Ascospore germination of the black kame (Terfezia boudieri). Mycologia 72(1): 50-54, 1980.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation