To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X

Clavispora lusitaniae Rodrigues de Miranda (ATCC® 38533)

Strain Designations: CBS 6936 [CCRC 21387, IFO 10059, IGC 4093, JCM 7533, NRRL Y-11826]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida lusitaniae van Uden et do Carmo Sousa
Strain Designations CBS 6936 [CCRC 21387, IFO 10059, IGC 4093, JCM 7533, NRRL Y-11826]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type MATa
Comments Genome sequencing strain (Bordeaux University, France)
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28/26S ribosomal RNA gene, partial sequence

AAGGATCATTAAAAAAAATTATACACACTGTTTTTGCGAACAAAAAAATAAATCTTTTATTCGAATTTCTTAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGCATCCCCTCTAACCCCCGGTTAGGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACACGTTTACAGCACGACATTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28/26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTGCGGGAATTGTAATTTGAAGGTTTCGTGGTCTGAGTCGGCCGCGCCCAAGTCCATTGGAACATGGCGCCTGGGAGGGTGAGAGCCCCGTATGGCGCACGCCGACTCTTTGCACCGCGGCTCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGTTTTACCGGGCCAGCGTCAAATAAACGGGGGGGAAAAGGGGGAAAGAATGTGGCGCGTGCCTTCGGGTTCGCGTGTTATAGCTTTCTCTAATACCCCCATGTTTGTTTGAGGCCTGCGATTCTAGGACGCTGGCGTAATGGTTGCAAGCCG

Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- I. Mateles
Isolation
Citrus peel juice, Israel
Cross References

Nucleotide (GenBank) : LYUB00000000 Clavispora lusitaniae strain CBS 6936, whole genome shotgun sequencing project

References

Rodrigues de Miranda L. Clavispora, a new yeast genus of the Saccharomycetales. Antonie van Leeuwenhoek 45: 479-483, 1979. PubMed: 554535

Young LY, et al. A STE12 homolog is required for mating but dispensable for filamentation in Candida lusitaniae. Genetics 155: 17-29, 2000. PubMed: 10790381

Kurtzman CP, Robnett CJ. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species. FEMS Yeast Res. 13: 23-33, 2013. PubMed: 22978764

Guzman B, Lachance MA, Herrera CM. Phylogenetic analysis of the angiosperm-floricolous insect-yeast association: Have yeast and angiosperm lineages co-diversified? Mol Phylogenet Evol 68: 161-175, 2013. PubMed: 23583418

El-Kirat-Chatel S, Dementhon K, Noel T. A two-step cloning-free PCR-based method for the deletion of genes in the opportunistic pathogenic yeast Candida lusitaniae. Yeast 28: 321-330, 2011. PubMed: 21456057

Tsui CK, et al. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. 8: 651-659, 2008. PubMed: 18248416

Chapeland-Leclerc F, et al. Inactivation of the FCY2 gene encoding purine-cytosine permease promotes cross-resistance to flucytosine and fluconazole in Candida lusitaniae. Antimicrob Agents Chemother 49: 3101-3108, 2005. PubMed: 16048910

Francois F, et al. Development of an integrative transformation system for the opportunistic pathogenic yeast Candida lusitaniae using URA3 as a selection marker. Yeast 21: 95-106, 2004. PubMed: 14755635

Diezmann S, et al. Phylogeny and evolution of medical species of Candida and related taxa: a multigenic analysis. J Clin Microbiol 42: 5624-5635, 2004. PubMed: 15583292

Lachance MA, et al. The D1/D2 domain of the large-subunit rDNA of the yeast species Clavispora lusitaniae is unusually polymorphic. FEMS Yeast Res 4: 253-258, 2003. PubMed: 14654429

Daniel HM, Sorrell TC, Meyer W. Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs. Int J Syst Evol Microbiol 51: 1593-1606, 2001. PubMed: 11491363

Lachance MA, et al. Ribosomal DNA, species structure, and biogeography of the cactophilic yeast Clavispora opuntiae. Can J Microbiol 46: 195-210, 2000. PubMed: 10749533

Durrens P, et al. Genome sequence of the yeast Clavispora lusitaniae type strain CBS 6936. Genome Announc. 5(31). pii: e00724-17, 2017. PubMed: 28774979

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation