To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. Our first job is to listen to and observe what our customers need, and meet those needs with quality products and services. While we are not currently experiencing delays due to this pandemic, we expect that we could see them as the situation evolves. If you experience any issues, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you for your understanding, patience and flexibility as ATCC does everything it can to help reduce the impact of the coronavirus pandemic to our valued customers.
X

Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 24657)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: D273-10B  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces cerevisiae Hansen
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations D273-10B
Alternate State Candida robusta Diddens et Lodder
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype MATalpha mal [rho+]
Preceptrol® no
Ploidy haploid
Comments
CANs
Cytochrome c oxidase subunits
Polyprotein precursor to cytochromes oxidase
Monoclonal antibodies to yeast catalase T
Mitochondrial ATPase complex
Mitochondrial membrane biogenesis
Mitochondrial import receptors
Cloning of phosphate transport protein gene
Forms pseudohyphae
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28/26S ribosomal RNA gene, partial sequence

AAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAG


D1D2 region of the 28/26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCG

Name of Depositor F Sherman
Cross References

Nucleotide (GenBank) : J02633 Yeast (S.cerevisiae) COX9 gene encoding subunit VIIa of cytochrome

References

. . Genetics 49: 39, 1964.

Adolf GR, et al. Monoclonal antibodies to yeast catalase T. Biochem. Biophys. Res. Commun. 95: 350-356, 1980. PubMed: 6998463

Mayer VW. Mutagenic effects induced in Saccharomyces cerevisiae by breakdown products of I-naphthylamine and 2-naphthylamine formed in an enzyme-free hydroxylation system. Mutat. Res. 15: 147-153, 1972. PubMed: 4559038

Sevarino KA, Poyton RO. Mitochondrial membrane biogenesis: identification of a precursor to yeast cytochrome c oxidase subunit II, an integral polypeptide. Proc. Natl. Acad. Sci. USA 77: 142-146, 1980. PubMed: 6244538

Phelps A, et al. Cloning and characterization of the mitochondrial phosphate transport protein gene from the yeast Saccharomyces cerevisiae. Biochemistry 30: 248-252, 1991. PubMed: 1840493

Wright RM, et al. Reversible pseudohyphal growth in haploid Saccharomyces cerevisiae is an aerobic process. Curr. Genet. 23: 388-391, 1993. PubMed: 8319293

Mayer VW. Mutagenicity of dimethylnitrosamine and diethylnitrosamine for Saccharomyces in an in vitro hydroxylation system. Mol. Gen. Genet. 112: 289-294, 1971. PubMed: 5129794

Cabral F, Schatz G. Identification of cytochrome c oxidase subunits in nuclear yeast mutants lacking the functional enzyme. J. Biol. Chem. 253: 4396-4401, 1978. PubMed: 207698

Woodrow G, Schatz G. The role of oxygen in the biosynthesis of cytochrome c oxidase of yeast mitochondria. J. Biol. Chem. 254: 6088-6093, 1979. PubMed: 221490

Todd RD, et al. The yeast mitochondrial adenosine triphosphatase complex. Subunit stoichiometry and physical characterization. J. Biol. Chem. 255: 5461-5467, 1980. PubMed: 6445366

Lithgow T, Schatz G. Import of the cytochrome oxidase subunit Va precursor into yeast mitochondria is mediated by the outer membrane receptor Mas20p. J. Biol. Chem. 270: 14267-14269, 1995. PubMed: 7782281

Poyton RO, McKemmie E. A polyprotein precursor to all four cytoplasmically translated subunits of cytochrome c oxidase from Saccharomyces cerevisiae. J. Biol. Chem. 254: 6763-6771, 1979. PubMed: 221509

Poyton RO, McKenmie E. Post-translational processing and transport of the polyprotein precursor to subunits IV to VII of yeast cytochrome c oxidase. J. Biol. Chem. 254: 6772-6780, 1979. PubMed: 221510

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation