Ascosphaera apis (Maassen ex Claussen) Olive et Spiltoir, teleomorph (ATCC® MYA-4450)

Strain Designations: ARSEF 7405 [A10]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations ARSEF 7405 [A10]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Mating Type identified as minus or female
Comments
Honey bee pathogen; causing Chalkbrood, the honey bee (Apis mellifera) larval disease.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTAATGTGTGTCTGTGCGGCTAGGTGCCCCTAAACAAGGCCCTGCCGCGCACTCCCACCCTTGTCTACCTTACCTGTTGCTTCGGCGGGCCTGCGGGTTCTCGCGAGCCTGCTGCCGGAGGGGTTAGTTCCCCCCTGGCTAGCGTCCGCCGAAGATAAACGAACTCCAGTCGAAGATTGAAGTCTGAAGAAAATTGATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCACGGCTTGTGTGTTGGGCGATCGTCCCGTCTTAGGAGGGACGCGCCCGAAAGGCAGTGACGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCTTTCGCTCTAGTGGCCTGGCCGACTGTCCGGTCTAACCATCATTTACTTCTAGTGGTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGGAGAGGATGCTCTGGGAGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTGCAACCGTGTAGAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCACATGCGACCAGAGTCGGCCGTGGGGGTTCAGCAGGGGTTCTCCCCTGTGTATTCCCCTGCGGTCGGGCCAGCATCAGTTCTGGCGGCCGGTTAAAGGCTTCGGGAATGTATCCTCCTCCGGGAGGTCTTATAGCCCGAGGTGCAATGCGGCCAGCCGGGACTGAGGAACGCGCTTCGGCACGGATGCTGGCTTAATGGTCGTTTGTGGC

Name of Depositor RA Humber
Special Collection ATCC
Chain of Custody
ATCC <-- RA Humber <-- KD Murray
Isolation
Apis mellifera (honeybee mummy infected with chalkbrood fungus), Weslaco, TX, USA.
Cross References

Nucleotide (GenBank) : FJ172292 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146384 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AARE01000000 Ascosphaera apis ARSEF 7405 strain USDA-ARSEF 7405, whole genome shotgun sequencing project

References

Qin X, et al. Genome sequences of the honey bee pathogens Paenibacillus larvae and Ascosphaera apis. Insect Mol. Biol. 15: 715-718, 2006.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation