Cryptococcus laurentii (Kufferath) Skinner, anamorph (ATCC® MYA-2946)

Strain Designations: C #2  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cryptococcus laurentii
Strain Designations C #2
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 2219: Corn meal agar, half-strength
Growth Conditions
Temperature: 20.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAAGGATCATTAAAGATTGACCGAAAGGTCTTATCTCTATATCCCTCACCTCTGTGAACTGTGGACCTCCGGGTCTATTTAACAAACATCAGTGTAATGAACGTATATATCATTAAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAATCCCCCTGGGTTTATGATCTGGGTCGGACTTGGATATGGGCGTCTGCCGGTCACACGGCTCGCCTCAAATGACTTAGTGGATCTCTCTGCATCCGTGACAGACGTAATAAGTTTCGTCTTGTCCCTTGCTTATGAGTCTGCTCATAACCTGCCATCGCGCACTTTAGACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT

Name of Depositor EF Haskins
Special Collection Eumycetozoan Special Collection
Cross References

Nucleotide (GenBank) : FJ545224 ITS including 5.8S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation