Cryptococcus laurentii (Kufferath) Skinner, anamorph (ATCC® MYA-2946)

Strain Designations: C #2  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cryptococcus laurentii
Strain Designations C #2
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 2219: Corn meal agar, half-strength
Growth Conditions
Temperature: 20.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGCGGAAGGATCATTAAAGATTGACCGAAAGGTCTTATCTCTATATCCCTCACCTCTGTGAACTGTGGACCTCCGGGTCTATTTAACAAACATCAGTGTAATGAACGTATATATCATTAAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAATCCCCCTGGGTTTATGATCTGGGTCGGACTTGGATATGGGCGTCTGCCGGTCACACGGCTCGCCTCAAATGACTTAGTGGATCTCTCTGCATCCGTGACAGACGTAATAAGTTTCGTCTTGTCCCTTGCTTATGAGTCTGCTCATAACCTGCCATCGCGCACTTTAGACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT

Name of Depositor EF Haskins
Special Collection Eumycetozoan Special Collection
Cross References

Nucleotide (GenBank) : FJ545224 ITS including 5.8S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation