ATCC 100 Years Logo Anniversary ATCC 100 Years Logo Anniversary Cart 0
  • Quick Order
  • Careers
  • Support

Aspergillus niger van Tieghem

6275

Download Genome Learn about the ATCC Genome Portal
An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.
Product category
Fungi
Strain designation
4247 [AM 324, CBS 131.52, CBS 769.97, DSM 1957, IFO 6341, IMI 45551, J. Friedrich A98, KCC F-0086, NRRL 334, QM 324, QM 458, Steinberg, TC 215-4247, WB 334]
Type strain
No
Genome sequenced strain
Yes
Isolation source
Leather
Applications
Bioremediation
Quality control
Product format
Freeze-dried
Storage conditions
2°C to 8°C
Buy Now
Price: $297.00 EA
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Specific applications
Assay of sulfur
Degrades apple distillery waste
Fungus resistance testing
Fungus resistance testing adhesives
Fungus resistance testing aircraft transmissions
Fungus resistance testing automotive components
Fungus resistance testing baking primer
Fungus resistance testing carpets
Fungus resistance testing lacquer
Fungus resistance testing leather
Fungus resistance testing packing materials
Fungus resistance testing paint
Fungus resistance testing paper and paperboard
Fungus resistance testing plastics
Fungus resistance testing sandbags
Fungus resistance testing textiles
Fungus resistance testing varnish
Produces carboxymethyl cellulase CM-celluase
Produces citric acid citrate
Produces glucosidase, beta; acid Glucosidase; glucocerebrosidase
Produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase
Resistant to copper
Sterility testing
Testing
Testing slimicide
Degrades starch in wastewater
Produces carboxymethyl cellulase, beta-glucosidase, and xylanase from oil palm wastes
Produces extracellular lipases

Potential bioremediation agent: synthetic and industrial effluents, heavy metals, petroleum

Recommended as a test microorganism for AATCC TM 30: Antifungal Assessment and Mildew Resistance Test

Recommended as a test microorganism for AENOR UNE EN 1104: Paper and board intended to come into contact with foodstuffs - Determination of the transfer of antimicrobial constituents

Recommended as a test microorganism for ASTM D3273: Standard Test Method for Resistance to Growth of Mold on the Surface of Interior Coatings in an Environmental Chamber

Recommended as a test microorganism for ASTM D4576: Standard Test Method for Mold Growth Resistance of Wet Blue and Wet White

Recommended as a test microorganism for ISO 846: Plastics — Evaluation of the action of microorganisms

Preceptrol
No

Characteristics

Comments
Trace element nutrition studies
Leaching of aluminum from red mud

Handling information

Medium
Temperature
24-26°C
Atmosphere
Aerobic
Handling procedure

For freeze-dried (lyophilized) ampoules:

  1. Open an ampoule according to enclosed instructions.
  2. From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet. Stir to form a suspension.
  3. Aseptically transfer the suspension back into the test tube of sterile distilled water.
  4. Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
  5. Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
  6. Incubate the inoculum at the propagation conditions recommended.
  7. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 2 to 4 days of incubation. However, the time necessary for significant growth will vary from strain to strain.
Handling notes
No special notes.
Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC


Beta-tubulin (bTub)

TTGCCCTCCCCGTCCCTCGTCCGTCAGGAGACGCGTCGTTGGTTGGCATCTCTTTTGCTCGGGACCCCACCGGTTCTTCGACCAACTCATTCTTGTGCTAACTGCATGTCTTCTTCGCTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCCAATATATGCTTCGGATGATTGCCCCCAAGGGTCTTGATTGGTGTTTGGTGGACTAAACAATATATCATGGTGGTTAGGGTAACCAAATTGGTGCTGCTTTCTGGTACGTATACAACTGCCATTGGATTGGGGATGGAACATCGTCTCTTAGGCTATCTCAGCTTGAGTTCAGATGTTGTCCATTAGGTACATGCTATCGGTCTAAGAACACGTCTAACAATTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTCACACCTCTCAATTGGTCAACAATGGGCAAAGGGTTGGGTCTTCTGACACGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTGAGATCCATCGGACCTTGGCTTTTTCACGACAATATCATCAATGTCCTAATCACTTCAGCAGGCTAGCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG

Verification method
Whole-genome Sequencing

History

Deposited as
Aspergillus niger van Tieghem
Synonyms
Aspergillus niger mut. cinnamomeus (Schiemann) Thom et Raper Aspergillus niger mut. schiemanni Aspergillus niger var. altipes SchiemannAspergillus cinnamomeus Schiemann, ~
Depositors
C Thom
Chain of custody
ATCC <-- C Thom <-- RA Steinberg
Cross references
GenBank GU256739 ITS including 5.8S rRNA gene
GenBank KU729128 D1/D2 region of 28S rRNA gene
GenBank KU897010 beta-tubulin (TUB2) gene

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Kikuchi K, et al. Method of producing carbon source for citric acid fermentation. US Patent 4,040,906 dated Aug 9 1977

Pabai F, et al. Interesterification of butter fat by partially purified extracellular lipases from Pseudomonas putida, Aspergillus niger and Rhizopus oryzae. World J. Microbiol. Biotechnol. 11: 669-677, 1995.

Prasertsan P, Oi S. Production of cellulolytic enzymes from fungi and use in the saccharification of palm cake and palm fibre. World J. Microbiol. Biotechnol. 8: 536-538, 1992.

Iwahori K, et al. Substrate permeability in pellets formed by Aspergillus niger. J. Ferment. Bioeng. 79: 387-390, 1995.

Steinberg RA. Sulfur and trace-element nutrition of Aspergillus niger. J. Agric. Res. 63: 109-127, 1941.

View All Curated Citations for this Product

For product-related inquiries and issues, contact Product Experience:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time