Scheffersomyces stipitis (Pignal) Kurtzman et Suzuki (ATCC® 58785)

Strain Designations: CBS 6054 [CCRC 21777, IFO 10063, NRRL Y-11545]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Pichia stipitis Pignal, teleomorph
Strain Designations CBS 6054 [CCRC 21777, IFO 10063, NRRL Y-11545]
Application
Bioethanol production
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Genome Sequenced Strain

Yes

Comments
Use of corn steep liquor in fermentation of D-xylose
Genome sequencing strain (completed by the Joint Genome Institute at the Department of Energy, USA).
Morphology On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells subglobose to ellipsoid, smooth, guttulate, 4-8 X 3-5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
ITS sequence

AAGGATCATTACAGTATTCTTTTTGCCAGCGCTTAACTGCGCGGCGAAAAAACCTTACACACAGTGTTTTCTTTATTAGAAACTATTGCTTTGGTCTGGCTCAGAAATGAGTTGGGCCAGAGGTTTACCAAACTTCAATTTTATTGAATTGTTATTTTATTAATTTGTCAATTTGTTGATTAAATTCAAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAAAGTATTGGCACGAGTGGTACTAAATAGTACTGACAGAATATTTCAATGTATTAGGTTTATCCAACTCGTTGAGACTTCTGGCGGTGAATTTTTGGTATATTGGCTTTGCCTTACAAAACAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA

 

D1D2 sequence

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTCAGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCTGATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTTGGTATTTTGTATGTCTTGCTTTCGGGTGGGGCCTCTACAGTTTACTGGGCCAGCATCGGTTTGGACGGTAGGATAATGACATTGGAATGTGGCACCACTTCGGTGGTGTGTTATAGACTTTGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCATAATGATCTTAAACCG

Morphology On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells subglobose to ellipsoid, smooth, guttulate, 4-8 X 3-5 µm.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- J Santa Maria
Cross References

Nucleotide (GenBank) : AF030426 nucleotide sequence of PsCYC1

Nucleotide (GenBank) : U08628 Pichia stipitis CBS 6054 ATCC 58785 autonomous replication

Nucleotide (GenBank) : U08629 Pichia stipitis CBS 6054 ATCC 58785 orotidine-5'-phosphate

Nucleotide (GenBank) : AF127801 Pichia stipitis xylitol dehydrogenase (XYL2) gene, complete cds.

Nucleotide (GenBank) : CM000437 Pichia stipitis CBS 6054 chromosome 1, whole genome shotgun sequence.

Complete Genome (GenBank) : AAVQ00000000 Scheffersomyces stipitis CBS 6054 chromosome 1, whole genome shotgun sequencing project

References

Toivola A, et al. Alcoholic fermentation of D-xylose by yeasts. Appl. Environ. Microbiol. 47: 1221-1223, 1984.

Deed RW, et al. Xylitol production by recombinant Saccharomyces cerevisiae. Bio-Technology 9: 1090-1095, 1991. PubMed: 1367625

. . Biotechnol. Lett. 16: 211-214, 1994.

Shi NQ, et al. Disruption of the cytochrome c gene in xylose-utilizing yeast Pichia stipitis leads to higher ethanol production. Yeast 15: 1021-1030, 1999. PubMed: 10455226

Jeffries TW, et al. Genome sequence of the lignocellulose-bioconverting and xylose-fermenting yeast Pichia stipitis. Nat. Biotech. 25: 319-326, 2007.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation