Trichoderma reesei Simmons, anamorph (ATCC® 56765)

Strain Designations: NRRL 11460 [NRCC 2906, RUT-C30, VTT-D-86271]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL 11460 [NRCC 2906, RUT-C30, VTT-D-86271]
Application
Produces acetylesterase acetyl esterase
Produces alkaline xylan endo-1,3-beta-xylosidase alkaline xylanase
Produces alpha-L-arabinofuranosidase alpha-1,3-arabinosidase
Produces alpha-galactosidase
Produces alpha-glucuronidase
Produces cellobiohydrolases I and II
Produces endoglucanase
Produces exo-cellobiohydrolase avicelase, endoglucanase I
Produces lactase
Produces mannan endo-1,4-beta-mannosidase beta-mannanase, mannanase
Produces polygalacturonase endopolygalacturonase, pectinase
Produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase
Transformation host
Produces beta-xylanases I and II
Produces cellulase-poor xylanases
Enhancement of cellulase production with citric acid
Transformation host for expression of Phlebia radiata laccase gene
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Ethanol- and polyene-resistant
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Morphology After 6 days on Potato Dextrose agar at 25°C, colony is low, velutinous, mycelium white, conidia blue-green en masse; reverse vibrant yellow. Conidia ovoid, green, smooth-walled.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCTTCCGTCGCGGCTCTGTTTTACCTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCGTGTCCAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCCCTGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC

Morphology After 6 days on Potato Dextrose agar at 25°C, colony is low, velutinous, mycelium white, conidia blue-green en masse; reverse vibrant yellow. Conidia ovoid, green, smooth-walled.
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- Rutgers Univ. RUT-C30
Isolation Not available.
Cross References

Nucleotide (GenBank) : X93938 T.reesei rRNA genes and ITS1 and ITS2 DNA (strain ATCC 56765

References

Saddler JN, et al. Utilization of enzymatically hydrolyzed wood hemicelluloses by microorganisms for production of liquid fuels. Appl. Environ. Microbiol. 45: 153-160, 1983.

Saloheimo M, et al. A lignin peroxidase-encoding cDNA from the white-rot fungus Phlebia radiata: characterization and expression in Trichoderma reesei. Gene 85: 343-351, 1989. PubMed: 2628172

Bailey MJ, et al. Effect of pH on production of xylanase by Trichoderma reesei on xylan- and cellulose-based media. Appl. Microbiol. Biotechnol. 40: 224-229, 1993.

Kristufek D, et al. Coinduction of alpha-L-arabinofuranosidase and alpha-D-galactosidase formation in Trichoderma reesei RUT C-30. FEMS Microbiol. Lett. 115: 259-264, 1994.

Haab D, et al. Protein hypersecretory Trichoderma reesei mutant RUT C-30 displays increased ethanol and polyene resistance. J. Biotechnol. 29: 97-108, 1993.

Stralbrand H, et al. Purification and characterization of two beta-mannanases from Trichoderma reesei. J. Biotechnol. 29: 229-242, 1993.

Sundberg M, Poutanen K. Purification and properties of two acetylxylan esterases of Trichoderma reesei. Biotechnol. Appl. Biochem. 13: 1-11, 1991.

Saloheimo M, Niku-Paavola ML. Heterologous production of a ligninolytic enzyme: expression of the Phlebia radiata laccase gene in Trichoderma reesei. Bio-Technology 9: 987-990, 1991.

Nyyssonen E, et al. Efficient production of antibody fragments by the filamentous fungus Trichoderma reesei. Bio-Technology 11: 591-595, 1993. PubMed: 7763606

Kurzatkowski W, et al. Ultrastructural localization of cellular compartments involved in secretion of the low molecular weight, alkaline xylanase by Trichoderma reesei. Arch. Microbiol. 159: 417-422, 1993.

Poutanen K, et al. Deacetylation of xylans by acetyl esterases of Trichoderma reesei. Appl. Microbiol. Biotechnol. 33: 506-510, 1990.

Gamerith G, et al. Cellulase-poor xylanases produced by Trichoderma reesei RUT C-30 on hemicellulose substrates. Appl. Microbiol. Biotechnol. 38: 315-322, 1992.

Ehsani N, et al. Separation of enzymes produced by Trichoderma reesei with hydrophobic ultrafiltration membranes. Process Biochem. 31: 253-263, 1996.

Siika-Aho M, et al. An alpha-glucuronidase from Trichoderma reesei RUT C-30. Enzyme Microb. Technol. 16: 813-819, 1994.

Zeilinger S, et al. Conditions of formation, purification, and characterization of an alpha-galactosidase of Trichoderma reesei RUT C-30. Appl. Environ. Microbiol. 59: 1347-1353, 1993. PubMed: 8390816

Kadam KL, Keutzer WJ. Enhancement in cellulase production by Trichoderma reesei Rut-C30 due to citric acid. Biotechnol. Lett. 17: 1111-1114, 1995.

Watson TG, Nelligan I. Pilot scale production of cellulase by Trichoderma reesei (RUT C-30). Biotechnol. Lett. 5: 25-28, 1983.

Robison PD. Cellulase and xylanase production by Trichoderma reesei Rut C-30. Biotechnol. Lett. 6: 119-122, 1984.

Castillo FJ, et al. Lactase production in continuous culture by Trichoderma reesei Rut-C30. Biotechnol. Lett. 6: 593-596, 1984.

Kyriacou A, et al. Detection and characterization of the specific and nonspecific endoglucanases of Trichoderma reesei: evidence demonstrating endoglucanase activity by cellobiohydrolase II. Enzyme Microb. Technol. 9: 25-32, 1987.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation