Komagataella pastoris (Guilliermond) Yamada et al. (ATCC® 28485™)

Strain Designations: CBS 704 [CCRC 21531, DSMZ 70382, JCM 3650, NCYC 175, NRRL Y-1603]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Pichia pastoris (Guilliermond) Phaff, teleomorph
Strain Designations CBS 704 [CCRC 21531, DSMZ 70382, JCM 3650, NCYC 175, NRRL Y-1603]
Synonym Pichia pastoris (Guilliermond) Phaff
Application
degrades ethyl alcohol ethanol
degrades hydrogen peroxide
produces acetaldehyde
produces alcohol oxidase
produces single-cell protein SCP
produces single-cell protein from oxygenated hydrocarbons
produces natural flavor aldehydes
converts ethanol to acetaldehyde
Biosafety Level 1
Product Format freeze-dried
Type Strain yes RefPhaff HJ. A proposal for amendment of the diagnosis of the genus Pichia Hansen. Antonie van Leeuwenhoek 22: 113-116, 1956. , RefYamada Y, et al. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen. nov. (Saccharomycetaceae). Biosci. Biotechnol. Biochem. 59: 439-444, 1995. PubMed: 7766181
Genome Sequenced Strain

Yes

Comments
Pichia pastoris is a synonym for Komagaraella pastoris.
Morphology

After 3 days cells are spheroidal to ovoidal, and occur singly or in pairs.  Growth is cream-colored, dull to faintly glistening and butyrous.

Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C
Sequenced Data

>26S ribosomal RNA gene, partial sequence

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGTCCACCTTTGAAGTATTGACGTGGTTGGGAGAGGTTATTGCACAAGTCGCCTGGAACGGCCGCCAAAGAGGGTGATAGCCCCGTAGCATACAACCAATCTTCCCAGCCGACAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAAGGTGGTAGGGTCCATCAAAGACTAAATATCAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAACAGTGCGTGAAATTGGGGGGAGGGAAGGCAAGGCCACGACAGTGGTCCTGCGCCCGTCTTGAAACACGG
Morphology

After 3 days cells are spheroidal to ovoidal, and occur singly or in pairs.  Growth is cream-colored, dull to faintly glistening and butyrous.

Name of Depositor CBS
Chain of Custody
ATCC <<--CBS<<--A. Guilliermond
Isolation
exudate of oak, France
Cross References

Nucleotide (GenBank) : JQ070155 D1/D2 region of 28S rRNA gene

References

Duff SJ, Murray WD. Production and application of methylotrophic yeast Pichia pastoris. Biotechnol. Bioeng. 31: 44-49, 1988.

Duff SJ, Murray WD. Comparison of free and immobilized Pichia pastoris cells for conversion of ethanol to acetaldehyde. Biotechnol. Bioeng. 31: 790-795, 1988.

Duff SJ, Murray WD. Production of flavor aldehydes using nongrowing whole cells of Pichia pastoris. Ann. N.Y. Acad. Sci. 542: 428-433, 1988.

Murray WD, et al. Induction and stability of alcohol oxidase in the methylotrophic yeast Pichia pastoris. Appl. Microbiol. Biotechnol. 32: 95-100, 1989.

Duff SJ, Murray WD. Oxidation of benzyl alcohol by whole cells of Pichia pastoris and by alcohol oxidase in aqueous and nonaqueous reaction media. Biotechnol. Bioeng. 34: 153-159, 1989.

Murray WD, et al. Catabolite inactivation in the methylotrophic yeast Pichia pastoris. Appl. Environ. Microbiol. 56: 2378-2383, 1990.

Wegner EH. Treatment of make-up water for use in a fermentation process for growth of yeast cells requiring growth factors. US Patent 4,226,939 dated Oct 7 1980

Duff SJB, et al. Production of natural flavor aldehydes from natural source primary alcohols C2-C7. US Patent 4,871,669 dated Oct 3 1989

Phaff HJ. A proposal for amendment of the diagnosis of the genus Pichia Hansen. Antonie van Leeuwenhoek 22: 113-116, 1956.

. . Appl. Microbiol. Biotechnol. 36: 82-86, 1991.

Yamada Y, et al. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen. nov. (Saccharomycetaceae). Biosci. Biotechnol. Biochem. 59: 439-444, 1995. PubMed: 7766181

. . Enzyme Microb. Technol. 11: 770-775, 1989.

. . Agric. Biol. Chem. 54: 1879-1882, 1990.

Murray WD, Duff SJB. Metabolism of hydrogen peroxide by Pichia pastoris. Agric. Biol. Chem. 54: 1967-1974, 1990.

type strain

Mattanovich D, et al. Genome, secretome and glucose transport highlight unique features of the protein production host Pichia pastoris. Microb. Cell Fact. 8: 29, 2009.

Phaff HJ. A proposal for amendment of the diagnosis of the genus Pichia Hansen. Antonie van Leeuwenhoek 22: 113-116, 1956.

Yamada Y, et al. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen. nov. (Saccharomycetaceae). Biosci. Biotechnol. Biochem. 59: 439-444, 1995. PubMed: 7766181

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS