Cryptococcus laurentii (Kufferath) Skinner, anamorph (ATCC® 18803)

Strain Designations: CBS 139 [CCRC 20527, CCY 17-3-2, DBVPG 6265, IFO 0609, IFO 0906, MUCL 30398, NRRL Y-2536, VKM Y-1665, VKPM Y-219]  /  Product Format: freeze-dried

Strain Designations CBS 139 [CCRC 20527, CCY 17-3-2, DBVPG 6265, IFO 0609, IFO 0906, MUCL 30398, NRRL Y-2536, VKM Y-1665, VKPM Y-219]
Application
Produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase
Quality control strain
Quality control strain for API products
Control strain for identification
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Comments
Alkali-tolerant at pH 10
Morphology On YM medium at 25°C after 7 days, colonies creamy white to dingy white, raised, smooth, margin entire. Cells subglobose to ellipsoidal, smooth, hyaline, 6-8 X 3-6 µm. Pseudohyphae not observed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAAGATTGACCGAAAGGTCTTATCTCTATATCCCTCACCTCTGTGAACTGTGGACCTCCGGGTCTGTCTTAACAAACATCAGTGTAATGAACGTATAAATCATTAAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAATCCCCCCGGGTTTATGATCTGGTCGGGACTTGGACATGGGCGTCTGCCGGTCACACGGCTCGCCTCAAATGACTTAGTGGATCTCTCTGCATCCGTGACAGACGTAATAAGTTTCGTCTTGTCCCTTGCGTACGAGTCCGCTCATAACCTGCCATCGCGCACTTTAGACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCAGGGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTTCCTTGGAACAGGATATCAAAGAGGGTGACAATCCCGTACTTGACACGACGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACCGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCGGTCGGGTCAACATCAGTTTTGTCCGGTGGATAAGGACGGTAGGAAGGTGGCACCCTCGGGTGTGTTATAGCCTGCCGTCGCATACATCGGGTGAGACTGAGGAACGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 7 days, colonies creamy white to dingy white, raised, smooth, margin entire. Cells subglobose to ellipsoidal, smooth, hyaline, 6-8 X 3-6 µm. Pseudohyphae not observed.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- H Kufferath
Isolation
Palm wine, malaffou, Congo
Cross References

Nucleotide (GenBank) : AF075469 Cryptococcus laurentii 26S ribosomal RNA gene, partial sequence.

Nucleotide (GenBank) : AF218974 Cryptococcus laurentii strain ATCC 18803T 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequnece; 28S ribosomal RNA gene, partial sequence.

References

Sutherland ES, et al. Production of double stranded ribonucleic acid. US Patent 3,597,318 dated Aug 3 1971

Kufferath H. Peut-on obtenir du mout de biere alcalin?. Ann. Bull. Seances Soc. R. Sci. Med. Nat. Bruxelles 74: 16-46, 1920.

Biely P, et al. Xylan-degrading activity in yeasts: growth on xylose, xylan and hemicelluloses. Folia Microbiol. 23: 366-371, 1978.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.

API 20C AUX. bioMerieux.

McTaggart LR, et al. Rapid identification of Cryptococcus neoformans and Cryptococcus gattii by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 49: 3050-3053, 2011. PubMed: 21653762