Eremothecium gossypii (Ashby et Nowell) Kurtzman (ATCC® 10895™)

Strain Designations: NRRL Y-1056 [CBS 109.51]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Ashbya gossypii (Ashby et Nowell) Guilliermond
Strain Designations NRRL Y-1056 [CBS 109.51]
Application
produces deaminase
produces isocitrate lyase
produces reductase
produces riboflavin vitamin B2
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Genome Sequenced Strain

Yes

Comments
Sequence of TEF gene
Formation and degradation of lipid bodies
Genome sequencing strain (completed by Biozentrum, University of Basel, Switzerland).
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
The ITS DNA sequence of 10895

CGCTAGTACCGATTGAATGGCTTAGTGAGGCCTCAGGATCTGCTTAGAGGAGGGGGCAACTCCACCTCAGAGCGGAAAATCTGGTCAAACTTGGTCATTTAGAGGAACTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAATGATTGGACAGTTCTGGGATGCAAAGTTCTGCCTGCGCTTAATTGCGCGGCGGCGCTATGTATCTGCTATCAGAGCTGTCTTACCAACACACATGTAGTTTCTACTATGCTTTTCTTCCTGGGCTGTCATGGCCCAGGGACAAACACAAACAAAAATTTTGAAAACTAGTCAAATCTATTTCATTAGAAATAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGTCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACCCTCGGGTTTGGTAATGAGTGATACTCGGTCGTAAGACAAGGTTAACTTGAAAATGCTGGCCATGGGCGGAACTTGCGCGGACTGCGGTCTGAGCTAGTTTCTACACTGCGTATTAGGTTTCGACCAGATCGTGGAGTGGAGCTGGCGCTTGAAGAACGTACGACAAACAAGGCCTTCCAGGCGAATAGTATTCCCAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAAT
Name of Depositor NRRL
Chain of Custody
ATCC <<--NRRL<<--W.J. Robbins
Isolation
highly pigmented variant of ATCC 8717
Cross References

Nucleotide (GenBank) : AJ010727 Ashbya gossypii icl gene.

Nucleotide (GenBank) : AJ009881 Ashbya gossypii vma1 gene.

Nucleotide (GenBank) : AJ005442 Eremothecium gossypii GLY1 gene.

Nucleotide (GenBank) : AX111256 Sequence 1989 from Patent WO0123604.

Nucleotide (GenBank) : X91046 A.gossypii AgTHR4 gene and putative orfs.

Nucleotide (GenBank) : X73978 A.gossypii TEF gene for translation elongation factor 1 alpha

Nucleotide (GenBank) : AE016814 Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I, complete sequence.

Nucleotide (GenBank) : AE016815 Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II, complete sequence.

Nucleotide (GenBank) : AE016816 Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III, complete sequence.

Nucleotide (GenBank) : AE016817 Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV, complete sequence.

Nucleotide (GenBank) : AE016818 Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V, complete sequence.

Nucleotide (GenBank) : AE016819 Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI, complete sequence.

Nucleotide (GenBank) : AE016820 Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII, complete sequence.

References

. . Appl. Microbiol. Biotechnol. 42: 121-127, 1994.

Steiner S, Philippsen P. Sequence and promoter analysis of the highly expressed TEF gene of the filamentous fungus Ashbya gossypii. Mol. Gen. Genet. 242: 263-271, 1994. PubMed: 8107673

Schmidt G, et al. Inhibition of purified isocitrate lyase identified itaconate and oxalate as potential antimetabolites for the riboflavin overproducer Ashbya gossypii. Microbiology 142: 411-417, 1996.

. . numerous NRRL publications 3: 29-34 and 91-95, 1971.

Ozbas T, Kutsal T. Comparative study of riboflavin production from two microorganisms: Eremothecium ashbyii and Ashbya gossypii. Enzyme Microb. Technol. 8: 593-596, 1986.

Hollander I, Brown GM. Biosynthesis of riboflavin: reductase and deaminase of Ashbya gossypii. Biochem. Biophys. Res. Commun. 89: 759-763, 1979. PubMed: 39563

Gattiker A, et al. Ashbya Genome Database 3.0: a cross-species genome and transcriptome browser for yeast biologists. BMC Genomics 8: 9, 2007.

Dietrich FS, et al. The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces cerevisiae genome. Science 304: 304-307, 2004.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS