American Type Culture Collection (ATCC) Logo American Type Culture Collection (ATCC) Logo 0
  • Quick Order
  • Careers
  • Support

Candida albicans (Robin) Berkhout

10231-MINI-PACK

ATCC® 10231-MINI-PACK™ consists of 6 ready-to-use vials of ATCC® 10231™ frozen in 200 µL of glycerol stock, eliminating the need to rehydrate and culture the strain prior to use. Each vial is provided with a 2-D barcode for easy storage and tracking, as well as peel-off labels for fast and reliable recordkeeping.
Product category
Fungi
Product type
Drug-resistant fungus
Yeast
Classification
Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Candida
Strain designation
3147 [CBS 6431, CCY 29-3-106, CIP 48.72, DSM 1386, IFO 1594, NCPF 3179, NCYC 1363, NIH 3147, VTT C-85161]
Type strain
No
Genome sequenced strain
Yes
Isolation source
Man with bronchomycosis
Applications
Agricultural research
Antimicrobial resistance research
Drug development
Food testing
Media testing
Quality control
Product format
Frozen
Shipping information
6 ready-to-use vials containing the strain in glycerol stock
Storage conditions
-80°C or colder
Buy Now
Price: $261.00 EA
Discounts may be available for our fellow nonprofit organizations. Login to see your price.

Generally ships within 1-3 business days

Documentation

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Detailed product information

General

Specific applications
ATCC® 10231-MINI-PACK™ consists of 6 ready-to-use vials of ATCC® 10231™ frozen in 200 µL of glycerol stock, eliminating the need to rehydrate and culture the strain prior to use. Each vial is provided with a 2-D barcode for easy storage and tracking, as well as peel-off labels for fast and reliable recordkeeping.  Developed by the leaders in microbial cultivation and preservation, ATCC® Minis provide a convenient, ready-to-use solution for handling quality control strains. ATCC® Minis are authenticated and backed by ATCC polyphasic testing – ensuring the same consistent and reliable reference materials you’ve come to trust for ATCC Genuine Cultures®. It is easy to ensure the quality of your products with ATCC® Minis – just open, plate, and go! .

Assay of amphotericin B fungizone
Assay of antimicrobial preservatives
Assay of haloprogin
Assay of nystatin fungicidin
Media testing
Membrane filter testing
Preparatory test control
Produces D-arabinolactone oxidase
Produces DNA topoisomerase
Food testing
Pharmaceutical and Personal Care
Produces aspartic proteinases aspartyl proteinases
Produces estrogen-binding protein
Produces lanosterol synthase 2,3-oxidosqualene lanosterol cyclase
Produces phenethyl alcohol
Produces polyamine oxidase
Produces tryptophol
Quality control strain
Sterility testing
Testing fungicides
Environmental monitoring
Preservative efficacy testing
Growth promotion testing
Bioburden testing
Microbial limit testing
Antimicrobial effectiveness testing
Disinfectant testing
Aseptic processing
Produces farnesoic acid, an autoregulatory substance capable of regulating morphological transition
Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified
Preceptrol
No

Characteristics

Serotype
A
Morphology
On YEPD agar after 2 days at 25°C, colonies are cream-colored, shiny, and smooth. Older colonies show filaments-like structure at the margin and may have ridges or folders. Cells are ovoid (3.0-6.0 x 4.0-8.0 µm), budding, mostly singly and rarely clustered in young culture. Cells will elongate and form chain-like branched pseudohyphae in older culture.
Comments
This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified.
For sterility testing, not more than five passages from the ATCC culture should be used.
Growth and invasiveness in mouse
Steroid interference with antifungal activity
Cell wall hydrophobicity enhances corticosterone incorporation.
Ultraviolet microscopy
Calcification
Morphology and physiology of strain sectors
Use of impedance for preservative efficacy testing
Fungitoxicity of alcohols and fatty acids
Esterase activity
Lipid composition
Effect of antineoplastic drugs

Handling information

Medium
Temperature
24-26°C
Atmosphere
Aerobic
Handling procedure
Frozen mini-cryovials packed in dry ice should either be thawed immediately for use or stored at or below
-70°C until the expiration date printed on the label. Storage at -20°C is acceptable for up to 1 year.

  1. To thaw a frozen mini-cryovial, place the vial upright in a 25°C to 30°C water bath, until just thawed (approximately 2-3 minutes).  Immerse the mini-cryovial just sufficient to cover the frozen material.  Do not agitate the mini-cryovial.
  2. Immediately after thawing, wipe down the mini-cryovial with 70% ethanol and aseptically transfer at least 50 µL (or 2-3 agar cubes) of the content onto a plate or broth with the recommended medium.
  3. Discard the empty vial. Do not refreeze any unused portion as it will result in a loss of viability.
  4. Incubate the inoculum/strain at the temperature and conditions recommended. Inspect for growth of the inoculum/strain regularly. Viability is typically noticeable after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.

 

Handling notes
This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified; For sterility testing, not more than five passages from the ATCC culture should be used; Purified genomic DNA of this strain is available as ATCC 10231D-5™.
Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.

Quality control specifications

Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTAACCTAGGATGTTGGCATAATGATCTTAA

Verification method
Whole-genome Sequencing

History

Deposited as
Candida albicans (Robin) Berkhout
Synonyms
Monilia pinoyi (Castellani) Castellani et Chalmers; Endomyces albicans (Robin) Vuillemin; Candida claussenii Lodder et Kreger-van Rij, anamorph; Candida stellatoidea (Jones et Martin) Langeron et Guerra, anamorph
Depositors
CW Emmons
Chain of custody
ATCC <-- CW Emmons <-- Wright
Type of isolate
Human
Patient gender
Male
Special collection
ATCC® Minis
Cross references
GenBank KU729138 D1/D2 region of 26S rRNA gene
GenBank D86430 Candida albicans gene for CaRho1, complete cds.
GenBank AX109674 Sequence 407 from Patent WO0123604.
GenBank X56867 C. albicans gene for secretory aspartate proteinase.
GenBank AF031229 Candida albicans alternative oxidase (AOX1) gene, complete cds.
GenBank U38534 Candida albicans alpha-tubulin (TUB1) gene, complete cds.
GenBank L22737 Candida albicans inositol-1-phosphate synthase (IN01) gene, complete cds.
GenBank AF031228 Candida albicans D-arabinono-1,4-lactone oxidase (ALO) gene,
GenBank U40454 Candida albicans topoisomerase type I (CATOP1) gene, complete cds.
GenBank EU266569 ITS including 5.8S rRNA gene

Legal disclaimers

Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

United States Veterinary Permit for Importation and Transportation of Controlled Materials and Organisms and Vectors

For every order of this item, you must provide a valid Permit for Importation and Transportation of Controlled Materials and Organisms and Vectors (VS Form 16-6A) obtained from the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Service. Note: These are considered live cultures, not diagnostic or analytics samples. We cannot ship this item until we receive this permit.

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

Frequently Asked Questions

References

Curated Citations

Lingappa BT, et al. Phenethyl alcohol and tryptophol: autoantibiotics produced by the fungus Candida albicans. Science 163: 192-194, 1969. PubMed: 5762768

Skowronski R, Feldman D. Characterization of an estrogen-binding protein in the yeast Candida albicans. Endocrinology 124: 1965-1972, 1989. PubMed: 2647470

Connolly P, et al. The use of impedance for preservative efficacy testing of pharmaceuticals and cosmetic products. J. Appl. Bacteriol. 76: 68-74, 1994. PubMed: 8144407

Klig LS, et al. Comparison of INO1 gene sequences and products in Candida albicans and Saccharomyces cerevisiae. Yeast 10: 789-800, 1994. PubMed: 7975896

ASTM International Standard Test Method for Preservatives in Water-Containing Cosmetics. West Conshohocken, PA

View All Curated Citations for this Product

For product-related inquiries and issues, contact Technical Service:

Message Us

Hours of Operation

Monday - Friday
9:00am - 5:00pm
US Eastern Time