Penicillium chrysogenum Thom, anamorph (ATCC® 10106)

Strain Designations: NRRL 807 [26, CBS 306.48, IMI 24314, LSHB Ad3 LSHB P19, QM 7500]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations NRRL 807 [26, CBS 306.48, IMI 24314, LSHB Ad3 LSHB P19, QM 7500]
Application
Produces chrysogenin
Quality control strain
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain yes
Intended Use
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CCGAAAACTTGGTCAAACTCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTC

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- C Thom 26
Isolation
Cheese, Connecticut
Cross References

Nucleotide (GenBank) : U57321 Penicillium chrysogenum class I chitin synthase (CHS1) gene,

Nucleotide (GenBank) : U57322 Penicillium chrysogenum class II chitin synthase (CHS2) gene,

Nucleotide (GenBank) : U57323 Penicillium chrysogenum class II chitin synthase (CHS3) gene,

Nucleotide (GenBank) : AF173559 Penicillium chrysogenum class III chitin synthase (CHS4) gene,

Nucleotide (GenBank) : AF241466 Penicillium chrysogenum small subunit ribosomal RNA gene, partial

References

Clutterbuck PW, et al. Studies in the biochemistry of micro-organisms. The formation from glucose by members of the Penicillium chrysogenum series of a pigment, an alkali-soluble protein and penicillin -- the antibacterial substance of Fleming. Biochem. J. 26: 1907-1918, 1932.

Thom C. Cultural studies of species of Penicillium. U.S. Dep. Agric. Bur. Anim. Ind. 118: 1-109, 1910.

FF MicroPlate. Biolog.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation