Penicillium chrysogenum Thom, anamorph (ATCC® 10106)

Strain Designations: NRRL 807 [26, CBS 306.48, IMI 24314, LSHB Ad3 LSHB P19, QM 7500]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL 807 [26, CBS 306.48, IMI 24314, LSHB Ad3 LSHB P19, QM 7500]
Application
Produces chrysogenin
Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CCGAAAACTTGGTCAAACTCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTC


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGTAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAACGAC

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- C Thom 26
Isolation
Cheese, Connecticut
Cross References

Nucleotide (GenBank) : U57321 Penicillium chrysogenum class I chitin synthase (CHS1) gene,

Nucleotide (GenBank) : U57322 Penicillium chrysogenum class II chitin synthase (CHS2) gene,

Nucleotide (GenBank) : U57323 Penicillium chrysogenum class II chitin synthase (CHS3) gene,

Nucleotide (GenBank) : AF173559 Penicillium chrysogenum class III chitin synthase (CHS4) gene,

Nucleotide (GenBank) : AF241466 Penicillium chrysogenum small subunit ribosomal RNA gene, partial

Nucleotide (GenBank) : HQ026745 ITS including 5.8S rRNA gene

References

Clutterbuck PW, et al. Studies in the biochemistry of micro-organisms. The formation from glucose by members of the Penicillium chrysogenum series of a pigment, an alkali-soluble protein and penicillin -- the antibacterial substance of Fleming. Biochem. J. 26: 1907-1918, 1932.

Thom C. Cultural studies of species of Penicillium. U.S. Dep. Agric. Bur. Anim. Ind. 118: 1-109, 1910.

FF MicroPlate. Biolog.

Houbraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation