Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 9080)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: 4228 [ATCC 24904, ATCC 46991, BI CZAS 0323/1, CBS 2354, CCRC 20855, CCY 48-76, DBVPG 6248, DSM 70424, IFO 0565, NCYC 74, NRRL Y-1089, VKM-366, VKPM Y-830, VTT C-66065]  /  Product Format: freeze-dried

Deposited As Saccharomyces carlsbergensis Hansen, teleomorph
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations 4228 [ATCC 24904, ATCC 46991, BI CZAS 0323/1, CBS 2354, CCRC 20855, CCY 48-76, DBVPG 6248, DSM 70424, IFO 0565, NCYC 74, NRRL Y-1089, VKM-366, VKPM Y-830, VTT C-66065]
Alternate State Candida robusta Diddens et Lodder
Application
Assay of pantothenic acid
Assay of pyridoxal
Assay of pyridoxamine
Assay of pyridoxine vitamin B6
Assay of vitamin B6 complex
Ferments maltose
Produces alpha-glucosidase maltase
Produces ergosterol
Produces nicotinic acid niacin
Produces pyrophosphatases
Produces yeast proteinase B inhibitor proteinase B inhibitor IB3
Food testing
Produces niacin-related compounds
Produces endo-deoxyribonuclease A
Produces alpha-glucosidase in brewery waste
Reduces 3-methoxy-8(14)-seco-1,3,5(10),9,(11)-estratetraene-14,17-dione
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Alpha-glucosidase synthesis
NADH oscillations
Spatio-temporal organization
Induction of giant cells
Sterol synthesis
Does not carry 2 micron DNA plasmid.
Genetics and biochemistry
Respiration
Oscillation in glycolysis
Morphology On YM medium at 25°C after 2 days, colonies white to dingy white, smooth, dull, butyrous, margin entire. Cells hyaline, broadly ovoid, smooth, 4.5-9 X 4-6 µm. Pseudohyphae not observed.
Medium Medium 200: YM agar or YM broth
Medium 1245: YEPD
Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

ATAATTTTGAAAATGGATTTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAG


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCG

Morphology On YM medium at 25°C after 2 days, colonies white to dingy white, smooth, dull, butyrous, margin entire. Cells hyaline, broadly ovoid, smooth, 4.5-9 X 4-6 µm. Pseudohyphae not observed.
Name of Depositor RE Eakin
Isolation Not available
References

Matern H, et al. Isolation, characterization and localization of the proteinase B inhibitor IB3 from Saccharomyces carlsbergensis. Eur. J. Biochem. 101: 325-332, 1979. PubMed: 118002

Hata S, et al. Involvement of cytochrome P-450 in delta22-desaturation in ergosterol biosynthesis of yeast. Biochem. Biophys. Res. Commun. 103: 272-277, 1981. PubMed: 7032523

Gibian H, et al. Production of optically active antipodes. US Patent 3,562,112 dated Feb 9 1971

Ando T, et al. Novel endo-deoxyribonuclease and process for the production thereof. European Patent Office Publ. No. 0060465A2 dated Sep 9 1982

Nishikawa Y, et al. Thiamine-induced alteration in sterol composition of Saccharomyces carlsbergensis 4228. Biochim. Biophys. Acta 531: 86-95, 1978. PubMed: 708751

Baumstark-Khan C, et al. Radiation induced formation of giant cells in Saccharomyces uvarum. II. Effect of X-rays on septum formation. Radiat. Environ. Biophys. 24: 9-16, 1985. PubMed: 3975354

. . J. Inst. Brew. 86: 78-80, 1980.

Berge AM. Genes for the fermentation of maltose and -methylglucoside in Saccharomyces carlsbergensis. Mol. Gen. Genet. 115: 80-88, 1972. PubMed: 5018453

Lichko L, Okorokov L. Purification and some properties of membrane-bound and soluble pyrophosphatases of yeast vacuoles. Yeast 7: 805-812, 1991. PubMed: 1664997

Baumstark-Khan C, et al. Radiation induced formation of giant cells (Saccharomyces uvarum). I. Budding process and chitin ring formation. Radiat. Environ. Biophys. 23: 19-30, 1984. PubMed: 6709826

. . J. Interdiscip. Cycle Res. 10: 41-50, 1979.

. . Adv. Biotechnol. 2: 225-230, 1981.

Arnezeder C, Hampel WA. Influence of growth rate on the accumulation of ergosterol in yeast cells in a phosphate limited continuous culture. Biotechnol. Lett. 13: 97-100, 1991.

Jacobsen H, et al. Spontaneous spatio-temporal organization in yeast cell suspension. J. Cell Sci. 43: 367-377, 1980. PubMed: 7419625

Arnezeder C, Hampel WA. Influence of growth rate on the accumulation of ergosterol in yeast cells. Biotechnol. Lett. 12: 277-282, 1990.

Berge AM, et al. Regulation of maltose fermentation in Saccharomyces carlsbergensis. I. The function of the gene MAL6, as recognized by mal6-mutants. Mol. Gen. Genet. 123: 233-246, 1973. PubMed: 4731427

Das J, Busse HG. Analysis of the dynamics of relaxation type oscillation in glycolysis of yeast extracts. Biophys. J. 60: 369-379, 1991. PubMed: 1832975

AOAC International Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine) in food extracts, microbiological method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 961.15.

AOAC International Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine) in ready-to-feed milk-based infant formula, microbiological method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 985.32.

Shin M, et al. Effect of L-tryptophan and L-leucine on biosynthesis of niacin-related compounds in Saccharomyces carlsbergensis. J. Nutr. Sci. Vitaminol. 28: 179-189, 1982. PubMed: 6215472

Atkin L, et al. Yeast microbiological methods for determination of vitamins. Pyridoxine. Ind. Eng. Chem. 15: 141-144, 1923.

Appleyard JG, Stanley DA. The evaluation of the vitamin B 6 status in children with convulsions. Med. Lab. Technol. 29: 160-170, 1972. PubMed: 5071462

Itagaki T, Tsukahara T. Microbiological assay of vitamin B 6 by thin-layer cup-plate method with Saccharomyces carlsbergensis. J. Vitaminol. 18: 90-96, 1972.

Windevoxhel M, Bahar S. Production of intracellular alpha-glucosidase in brewery waste by Saccharomyces carlsbergensis. Acta Cient. Venez. 40: 40-45, 1989. PubMed: 2700112

Tsuji K. Liquid nitrogen preservation of Saccharomyces carlsbergensis and its use in a rapid biological assay of pantothenic acid. Appl. Microbiol. 14: 462-465, 1966. PubMed: 5970831

van der Zeijst BA, et al. In vitro protein synthesis in yeast polyuridylic acid-dependent incorporations of phenylalanine into endogenous peptidyl transfer RNA. Biochim. Biophys. Acta 294: 517-526, 1973. PubMed: 4705999

de Kroon RA, Koningsberger VV. An inducible transport system for alpha-glucosides in protoplasts of Saccharomyces carlsbergensis. Biochim. Biophys. Acta 204: 590-609, 1970. PubMed: 5441195

Foodstuffs --- Determination of vitamin B6 by microbiological assay. London, UK:British Standards Institution;British Standard DD ENV 14166:2001.