Aspergillus fumigatus Fresenius, anamorph (ATCC® 90241)

Strain Designations: W3568/2AF/88/2/1  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations W3568/2AF/88/2/1
Application
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Epidemiology, isolate 2
Preservation
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor DW Denning
Chain of Custody
ATCC <-- DW Denning <-- Stanford Univ. Hosp.
Isolation
Bronchioalveolar lavage of heart-lung transplant recipient, Stanford, CA
Cross References

Nucleotide (GenBank) : KC689326 ITS including 5.8S rRNA gene

References

Denning DW, et al. Quantitative preservation of viability of Aspergillus fumigatus. J. Med. Vet. Mycol. 30: 485-488, 1992. PubMed: 1287169

Denning DW, et al. Restriction endonuclease analysis of total cellular DNA of Aspergillus fumigatus isolates of geographically and epidemiologically diverse origin. J. Infect. Dis. 162: 1151-1158, 1990. PubMed: 1977804

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation