Saccharomyces cerevisiae Hansen (ATCC® MYA-4940)

Strain Designations: YVH10  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Saccharomyces cerevisiae
Strain Designations YVH10
Application Used in the yeast display method to isolate novel proteins based on various biological functions
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype MATalpha PDI1::GAPDH-PDI1::LEU2 ura3- 52 trp1 leu2-delta200 his3-delta200 pep4::HIS3 prb11.6R can1 GAL
Preceptrol® no
Comments YVH10 (Ura-, Trp-) is BJ5464 and is MAT-alpha. The other markers are: ura3-52 (a Ty element insertion with no detectable background reversion frequency), trp1 (an amber point mutation), leu2-delta200, his3-delta200, pep4:HIS3, prbd1.6R, can1, GAL. YVH10 has the yeast PDI gene integrated in tandem with the endogenous copy and is under the constitutive glyceraldehydes (GADPH) promoter with Leu2 as a selectable marker.
Morphology On YM medium at 30°C for 2 days, colonies creamy white to dingy white, butyrous, smooth, slightly raised, margin entire. Cells globose to subglobose, hyaline, smooth, contain oil droplets, 4-6 X 3-5 µm. Pseudohyphae not observed.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

CAATACGCCTCAGTATAAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGATAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAA


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Morphology On YM medium at 30°C for 2 days, colonies creamy white to dingy white, butyrous, smooth, slightly raised, margin entire. Cells globose to subglobose, hyaline, smooth, contain oil droplets, 4-6 X 3-5 µm. Pseudohyphae not observed.
Name of Depositor KD Wittrup
Chain of Custody ATCC <-- KD Wittrup
Isolation From parent strain BJ5464
References

Robinson AS, Hines V, Wittrup KD. Protein disulfide isomerase overexpression increases secretion of foreign proteins in Saccharomyces cerevisiae. Biotechnology 12(4): 381-384, 1994. PubMed: 7764684

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation