Saccharomyces cerevisiae Hansen (ATCC® MYA-4940)

Strain Designations: YVH10  /  Product Format: frozen

Deposited As Saccharomyces cerevisiae
Strain Designations YVH10
Application Used in the yeast display method to isolate novel proteins based on various biological functions
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype MATalpha PDI1::GAPDH-PDI1::LEU2 ura3- 52 trp1 leu2-delta200 his3-delta200 pep4::HIS3 prb11.6R can1 GAL
Preceptrol® no
Comments YVH10 (Ura-, Trp-) is BJ5464 and is MAT-alpha. The other markers are: ura3-52 (a Ty element insertion with no detectable background reversion frequency), trp1 (an amber point mutation), leu2-delta200, his3-delta200, pep4:HIS3, prbd1.6R, can1, GAL. YVH10 has the yeast PDI gene integrated in tandem with the endogenous copy and is under the constitutive glyceraldehydes (GADPH) promoter with Leu2 as a selectable marker.
Morphology On YM medium at 30°C for 2 days, colonies creamy white to dingy white, butyrous, smooth, slightly raised, margin entire. Cells globose to subglobose, hyaline, smooth, contain oil droplets, 4-6 X 3-5 µm. Pseudohyphae not observed.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

CAATACGCCTCAGTATAAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGATAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAA


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Morphology On YM medium at 30°C for 2 days, colonies creamy white to dingy white, butyrous, smooth, slightly raised, margin entire. Cells globose to subglobose, hyaline, smooth, contain oil droplets, 4-6 X 3-5 µm. Pseudohyphae not observed.
Name of Depositor KD Wittrup
Chain of Custody ATCC <-- KD Wittrup
Isolation From parent strain BJ5464
References

Robinson AS, Hines V, Wittrup KD. Protein disulfide isomerase overexpression increases secretion of foreign proteins in Saccharomyces cerevisiae. Biotechnology 12(4): 381-384, 1994. PubMed: 7764684