Cylindrocladium pseudonaviculatum Crous et al. (ATCC® MYA-4891)

Strain Designations: L-1  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Strain Designations L-1
Biosafety Level 1
Product Format frozen
Type Strain no
Comments
Plant pathogen (boxwood blight; causing a leaf spot disease on Pachysandra terminalis)
Morphology On PDA medium at 25°C after 9 days, mycelium has concentric color zonation from reddish brown to buff with patches of dense white cottony mycelium. Produces a tan to dark reddish brown exudate. Hyphae guttulate, hyaline to reddish brown.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174050:
AGGGATCATTACCGAGTTTACAACTCCCAAACCCCATGTGAACATACCTGTTTCGTTCCCTCGGCGGTGTCCGGAAACGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTTATAGTATCTTCTGAGTGAAAAAAACAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGAGCGTCCTCCGGGTCGCGCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAATACACCTCGCTCTGGAGTCTCGGCGCGGCCACGCCGTAAAACCCCAACTTTTTCTGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174039:
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCTTGGTTGATCATCCTGGGTTCTCCCTGGTGCACTCTTCCAGTTCAGGCCAGCATCAGTTCGCTGCGGGGGATAAAAGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCATAATACCCTGCTCCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Morphology On PDA medium at 25°C after 9 days, mycelium has concentric color zonation from reddish brown to buff with patches of dense white cottony mycelium. Produces a tan to dark reddish brown exudate. Hyphae guttulate, hyaline to reddish brown.
Name of Depositor JA LaMondia
Special Collection ATCC
Chain of Custody
ATCC <-- J LaMondia
Isolation
Buxus sempervirens 'suffructicosa', Connecticut, USA.
Geographical Isolation Connecticut, USA
Cross References

Nucleotide (GenBank) : JX174050 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174039 D1/D2 region of 28S rRNA gene

References

LaMondia JA, et al. First report of Cylindrocladium pseudonaviculatum causing leaf spot of Pachysandra terminalis. Plant Dis. (in press).

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation