Cryomyces antarcticus Selbmann et al. (ATCC® MYA-4880)

Strain Designations: CBS 116301 [CCFEE 534, F44 A812-Hb5]  /  Product Format: frozen

Strain Designations CBS 116301 [CCFEE 534, F44 A812-Hb5]
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
meristematic fungus
Morphology On malt extract medium at 20°C after 32 days, Colonies black, raised, with a carbonized, crusty texture. Hyphae dematiaceous, thick walled, closely septate. Conidia globose to subglobose, reddish brown, verrucose to warty texture, produced in long chains, 7.5-10.5µm X 6.75-9µm.
Medium Medium 324: Malt extract agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 15°C to 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906770:

AAGGATCATTACCGAGACCGGGTCCAAACGGCCCGACCTCCAACCCTCTGTGTACATACCACGTTGCCTTGGCGGGCCCGCGGGTCCAGTGCCCGCGGCCGGCCCGCGCCGGTCAGCGCCCGCCAGAGGACCTCAAAACTCCGTTCATCAGTGTCGTCCGAGATATGAACTTAAATGAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCACTCAAGCACCGCTTGGTATTGGGCCCTCGTCCTCACCCGACGTGCCCCAAAGTCGTCGGCGGCGTCACCTGGCTTCGAGCGCAGTGATCTTTCCATCGCTCTGGAAGCCCCGGTGGCCGTTTGCCAAACAACCCCAAACGCATCAAGGTTGACCTCGGATCAGGCAGGGATACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906765:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCTCGGGGTCCGAGTTGTGATTTGTAGAGGATGCTTCGGGGTCAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACCGGTTGCGCTCCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGCAGTTGCTCAACCTGTCTTCTGACCGGTGCACTCTTCTGCGGTCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGGCCCTGGGAACGTGGCTCCCCTCGGGGAGTGTTATAGCCCAGGGTGGAATGCAGCCCGCCCGGACTGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGA

Morphology On malt extract medium at 20°C after 32 days, Colonies black, raised, with a carbonized, crusty texture. Hyphae dematiaceous, thick walled, closely septate. Conidia globose to subglobose, reddish brown, verrucose to warty texture, produced in long chains, 7.5-10.5µm X 6.75-9µm.
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- L Selbmann
Isolation
Sandstone, Linnaeus Terrace, McMurdo Dry Valley, Southern Victoria Land, Antarctica.
Cross References

Nucleotide (GenBank) : JQ906770 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906765 D1/D2 region of 28S rRNA gene

References

Selbmann L, et al. Fungi at the edge of life: cryptoendolithic black fungi from Antarctic desert. Stud. Mycol. 51: 1-32, 2005.