Cryptococcus neoformans (Sanfelice) Vuillemin (ATCC® MYA-4566)

Alternate State: Filobasidiella neoformans Kwon-Chung  /  Strain Designations: WM628 [CBS 10080]  /  Product Format: frozen

Strain Designations WM628 [CBS 10080]
Alternate State Filobasidiella neoformans Kwon-Chung
Application
Emerging infectious disease research
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Antigenic Properties Serotype AD
Genotype VNIII, AFLP3
Preceptrol® no
Mating Type MATalpha
Comments
Reference strain of VN III, AFLP3 molecular type of C. neoformans.
Medium Medium 200: YM agar or YM broth
Medium 325: Malt extract agar (Blakeslee's formula)
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 of LSU rDNA of MYA-4566

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC


ITS of MYA-4566

TTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAAT

Name of Depositor KJ Kwon-Chung
Special Collection ATCC
Chain of Custody
ATCC <-- KJ Kwon-Chung <-- W Meyer <-- S Chen
Isolation
Human, Australia.
Cross References

Nucleotide (GenBank) : FJ914904 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914893 ITS including 5.8S rRNA gene

References

Meyer W, et al. Molecular Typing of IberoAmerican Cryptococcus neoformans Isolates. Emerg. Infect. Dis. 9: 189-195, 2003.

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334