Candida albicans (Robin) Berkhout, anamorph (ATCC® 90819)

Strain Designations: CATW 4/19  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations CATW 4/19
Application
Inhibition by host defense system
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Comments
Inhibition by host defense system
Morphology After 3 days on YM medium at 30°C, colonies are white to cream-colored, smooth, butyrous.  Yeast cells are globose to short-ovoid, thin-walled, single or with buds, occasionally forming short chains.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATGCTGCCAGCCTAGACCGAGGACTGCGGTTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGAAA

Morphology After 3 days on YM medium at 30°C, colonies are white to cream-colored, smooth, butyrous.  Yeast cells are globose to short-ovoid, thin-walled, single or with buds, occasionally forming short chains.
Name of Depositor PG Sohnle
Special Collection NCRR Contract
Isolation
Human isolate, Milwaukee, WI
References

Sohnle PG, Hahn BL. The fate of individual organisms during clearance of experimental cutaneous Candida albicans infections in mice. Acta Dermato-Venereol. 72: 241-244, 1992. PubMed: 1357874

Sohnle PG, et al. Antimicrobial activity of an abundant calcium-binding protein in the cytoplasm of human neutrophils. J. Infect. Dis. 163: 187-192, 1991. PubMed: 1984467

Sohnle PG, Hahn BL. Inhibition of pseudohyphal growth as a neutrophil-mediated host defense mechanism against experimental deep Candida albicans infections in mice. J. Lab. Clin. Med. 121: 235-243, 1993. PubMed: 8433039

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation