Trichosporon mucoides Gueho et Smith, anamorph (ATCC® 204094)

Strain Designations: Vitek 303483 [API 7704022]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations Vitek 303483 [API 7704022]
Application
Quality control strain
Quality control of Vitek2 ID-YST card
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGACCAGAGTTCAAGAATTGTCCGAAGACGATTAGAAGCGCACTTCTCAAGTCTACACCAGCGAAACTTATTACGCCAGATCGACAAGTTAATACGCTAACTCTTTTAAGGCGAGCCAGGCAAGTGGCAGCGCCCAAATCCAAGCCATTAAGAAACCCTAATGGTTGAGATTTCATGATACTCAAACAGGCATGCTCTCCGGAATACCAGAGAGCGCAAGTTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTATTTTTGTTATAATAACATGACGTTCATTACACAATGTTTGTAAAAGTAATTGACCGAAGTCAATCAACAGTTCACAGGTGTAGATGGATATAGTTTAACGCTCAAAGAGCA

Name of Depositor bioMerieux Vitek, Inc.
Special Collection NCRR Contract
Chain of Custody
ATCC <-- bioMerieux Vitek, Inc. <-- API 7704022
Isolation Not available
Cross References

Nucleotide (GenBank) : GU256762 ITS including 5.8S rRNA gene

References

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation