Penicillium marneffei Segretain et al., anamorph (ATCC® 18224)

Strain Designations: QM 7333 [CBS 334.59, IMI 68794, LSHB BB361]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations QM 7333 [CBS 334.59, IMI 68794, LSHB BB361]
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2
Product Format freeze-dried
Type Strain yes (. The genus Penicillium. London: Academic Press; 1979.), RefSegretain G. Description d'une nouvelle espece de Penicillium: Penicillium marneffei n. sp.. Bull. Soc. Mycol. Fr. 75: 412-416, 1959. , Ref. . Bull. Soc. Pathol. Exot. 49: 418-421, 1956.
Genome Sequenced Strain

Yes

Comments
fluorescent antibody test
Genome sequencing strain (J. Craig Venter Institute, USA).
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AATATGGTGGTGACCAACCCCCGCAGGTCCTTCCCGAGCGAGTGACAGAGCCCCATACGCTCGAGGACCAGACGGACGTCGCCGCTGCCTTTCGGGCAGGTCCCCGGAGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCA

TTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACAATTTTCATGGTACTCAGACAGTCCATCTTCATCAGGGTTCACAGGGCGCTTCGGCGGGCGCGGGCCCGGGGACAAACGTCCCCCGGCGACCGGGTGGCCCCGGTGGGCCCGCCAAAGCAACAGGTGTATAGAGACAAGGGTGGGAGGTTGGGCCGCGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGT

TCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCAAGTTTGACCAACTTTCCGGCTCTGAGCGGTCGTTGCCAACCCCTCTGAGCCAGTCCGAAGGCCTCACTGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCA

Name of Depositor QM
Chain of Custody
ATCC <<--QM<<--L. Ajello <<--- G. Segretain <<--- Capponi et Sureau
Isolation
bamboo rat, Rhizomys sinensis, Vietnam
Cross References

Nucleotide (GenBank) : L37406 Penicillium marneffei transcribed spacers 1 and 2 and 5.8S

Nucleotide (GenBank) : L37407 Penicillium marneffei mitochondrial small subunit ribosomal RNA

Complete Genome (GenBank) : ABAR01000000 Penicillium marneffei ATCC 18224, whole genome shotgun sequencing project.

Nucleotide (GenBank) : JQ354997 Penicillium marneffei strain ATCC 18224 mitochondrial sequence

References

. The genus Penicillium. London: Academic Press; 1979.

Segretain G. Description d'une nouvelle espece de Penicillium: Penicillium marneffei n. sp.. Bull. Soc. Mycol. Fr. 75: 412-416, 1959.

. . Bull. Soc. Pathol. Exot. 49: 418-421, 1956.

Kaufman L, et al. Development of specific fluorescent-antibody test for tissue form of Penicillium marneffei. J. Clin. Microbiol. 33: 2136-2138, 1995. PubMed: 7559962

. The genus Penicillium. London: Academic Press; 1979.

Segretain G. Description d'une nouvelle espece de Penicillium: Penicillium marneffei n. sp.. Bull. Soc. Mycol. Fr. 75: 412-416, 1959.

. . Bull. Soc. Pathol. Exot. 49: 418-421, 1956.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation