Candida albicans (Robin) Berkhout (ATCC® MYA-574)

Strain Designations: Gu5  /  Product Format: frozen

Strain Designations Gu5
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Fluconazole-resistant
Morphology After 3 days, colonies cream-colored, smooth, dull, dome-shaped.  Cells globose to short-ovoid, 2.0-7.0 x 3.0-8.5 µm, single or budding, occasionally forming short chains.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC


18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

AAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

Morphology After 3 days, colonies cream-colored, smooth, dull, dome-shaped.  Cells globose to short-ovoid, 2.0-7.0 x 3.0-8.5 µm, single or budding, occasionally forming short chains.
Name of Depositor J Morschhauser
Special Collection NCRR Contract
Chain of Custody ATCC <-- J Morschhauser
Isolation
Patient with AIDS, Germany; patient 3
Cross References

Nucleotide (GenBank) : KU729155 D1/D2 region of 26S rRNA gene

References

Franz R, et al. Molecular aspects of fluconazole resistance development in Candida albicans. Mycoses 42: 453-458, 1999. PubMed: 10546486