Candida albicans (Robin) Berkhout (ATCC® MYA-574™) Strain Designations: Gu5 / Product Format: frozen General Information Characteristics Culture Method Specifications History Documentation Print Email Share Share this product Facebook Twitter Google+ Permits and Restrictions View Permits Strain Designations Gu5 Biosafety Level 1 Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. Product Format frozen Storage Conditions Frozen: -80°C or colderFreeze-Dried: 2°C to 8°CLive Culture: See Propagation Section Type Strain no Preceptrol® no Comments Fluconazole-resistant Morphology After 3 days, colonies cream-colored, smooth, dull, dome-shaped. Cells globose to short-ovoid, 2.0-7.0 x 3.0-8.5 µm, single or budding, occasionally forming short chains. Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD Growth Conditions Temperature: 20°C to 25°CAtmosphere: Typical aerobic Sequenced Data D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence AAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG Morphology After 3 days, colonies cream-colored, smooth, dull, dome-shaped. Cells globose to short-ovoid, 2.0-7.0 x 3.0-8.5 µm, single or budding, occasionally forming short chains. Name of Depositor J Morschhauser Special Collection NCRR Contract Chain of Custody ATCC <-- J Morschhauser Isolation Patient with AIDS, Germany; patient 3 Cross References Nucleotide (GenBank) : KU729155 D1/D2 region of 26S rRNA gene References Franz R, et al. Molecular aspects of fluconazole resistance development in Candida albicans. Mycoses 42: 453-458, 1999. PubMed: 10546486 Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Basic Documentation Product Sheet Certificate of Analysis SDS Other Documentation Microbial Characterization Data