Ascosphaera apis (Maassen ex Claussen) Olive et Spiltoir, teleomorph (ATCC® MYA-4450)

Strain Designations: ARSEF 7405 [A10]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations ARSEF 7405 [A10]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Mating Type identified as minus or female
Comments
Honey bee pathogen; causing Chalkbrood, the honey bee (Apis mellifera) larval disease.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTAATGTGTGTCTGTGCGGCTAGGTGCCCCTAAACAAGGCCCTGCCGCGCACTCCCACCCTTGTCTACCTTACCTGTTGCTTCGGCGGGCCTGCGGGTTCTCGCGAGCCTGCTGCCGGAGGGGTTAGTTCCCCCCTGGCTAGCGTCCGCCGAAGATAAACGAACTCCAGTCGAAGATTGAAGTCTGAAGAAAATTGATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCACGGCTTGTGTGTTGGGCGATCGTCCCGTCTTAGGAGGGACGCGCCCGAAAGGCAGTGACGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCTTTCGCTCTAGTGGCCTGGCCGACTGTCCGGTCTAACCATCATTTACTTCTAGTGGTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGGAGAGGATGCTCTGGGAGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTGCAACCGTGTAGAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCACATGCGACCAGAGTCGGCCGTGGGGGTTCAGCAGGGGTTCTCCCCTGTGTATTCCCCTGCGGTCGGGCCAGCATCAGTTCTGGCGGCCGGTTAAAGGCTTCGGGAATGTATCCTCCTCCGGGAGGTCTTATAGCCCGAGGTGCAATGCGGCCAGCCGGGACTGAGGAACGCGCTTCGGCACGGATGCTGGCTTAATGGTCGTTTGTGGC

Name of Depositor RA Humber
Special Collection ATCC
Chain of Custody
ATCC <-- RA Humber <-- KD Murray
Isolation
Apis mellifera (honeybee mummy infected with chalkbrood fungus), Weslaco, TX, USA.
Cross References

Nucleotide (GenBank) : FJ172292 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146384 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AARE01000000 Ascosphaera apis ARSEF 7405 strain USDA-ARSEF 7405, whole genome shotgun sequencing project

References

Qin X, et al. Genome sequences of the honey bee pathogens Paenibacillus larvae and Ascosphaera apis. Insect Mol. Biol. 15: 715-718, 2006.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation