Saccharomyces mikatae Naumov et al. (ATCC® MYA-4448)

Strain Designations: CBS 8839 (IFO 1815; NCYC 2888)  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 8839 (IFO 1815; NCYC 2888)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA; Washington University School of Medicine, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGTGGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACAGTGAGAGATTTCTGTGTTTTTGTTATAGGACAACTAAAACCGTTTCAATACAACACACTGTGGAGTTTTTATATCTTTGCAACTTTTTCTTTGGGCTTTCGAGCAATCGGAGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTGTACTGAGCGTATTGGAACGTTATCAATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGGGCAATTTCGAGACCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTCAATGTGAAATGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCGTAGGAATGTAACTTGCTTCGGGAAGTATTATAGCCTGCGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCG

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Soil, Japan
Cross References

Nucleotide (GenBank) : FJ196730 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ196778 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AABZ00000000 Saccharomyces mikatae IFO 1815, whole genome shotgun sequencing project

Nucleotide (GenBank) : AACH00000000 Saccharomyces mikatae IFO 1815, whole genome shotgun sequencing project

References

Naumov GI, et al. Three new species in the Saccharomyces sensu stricto complex: Saccharomyces cariocanus, Saccharomyces kudriavzevii and Saccharomyces mikatae. Int. J. Syst. Evol. Microbiol. 50: 1931-1942, 2000. PubMed: 11034507

Kellis M, et al. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423: 241-254, 2003.

Cliften P, et al. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 30: 71-76, 2003. PubMed: 2775844

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Huang CH, Lee FL, Tai CJ. The beta-tubulin gene as a molecular phylogenetic marker for classification and discrimination of the Saccharomyces sensu stricto complex. Antonie van Leeuwenhoek 95: 135-142, 2009. PubMed: 19112604

Kurtzman CP, et al. Multigene phylogenetic analysis of pathogenic Candida species in the Kazachstania (Arxiozyma) telluris complex and description of their ascosporic states as Kazachstania bovina sp. nov., K. heterogenica sp. nov., K. pintolopesii sp. nov., and K. slooffiae sp. nov. J. Clin. Microbiol. 43: 101-111, 2005. PubMed: 15634957

Dandjinou AT, et al. A phylogenetically based secondary structure for the yeast telomerase RNA. Curr Biol 14: 1148-1158, 2004. PubMed: 15242611

Van Nues RW, Brown JD. Saccharomyces SRP RNA secondary structures: a conserved S-domain and extended Alu-domain. RNA 10: 75-89, 2004. PubMed: 14681587

Hittinger CT, Rokas A, Carroll SB. Parallel inactivation of multiple GAL pathway genes and ecological diversification in yeasts. Proc Natl Acad Sci USA 101: 14144-14149, 2004. PubMed: 15381776

Kurtzman CP, Robnett CJ. Phylogenetic relationships among yeasts of the 'Saccharomyces complex' determined from multigene sequence analyses. FEMS Yeast Res 3: 417-432, 2003. PubMed: 12748053

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation