Rhodotorula mucilaginosa (Jorgensen) Harrison var. mucilaginosa (ATCC® 9449)

Strain Designations: NRRL Y-1592 [CBS 17, CCRC 21667, IGC 4791, MUCL 30397, VKM Y-341]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Rhodotorula rubra (Demme) Lodder
Strain Designations NRRL Y-1592 [CBS 17, CCRC 21667, IGC 4791, MUCL 30397, VKM Y-341]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Rhodotorula rubra (Demme) Lodder)
Preceptrol® no
Comments
Available as Uniplus (Ref TM) ATCC 9449-U
Morphology

After 3 days at 25°C the cells are ovoidal to spherical  and may occur singly, in pairs, in short chains or small clusters.  There may be a light strawberry-pink ring and light to moderate sediment. 

Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATATAGGACGTCCAACTTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCACTTGTTTGGGATAGTAACTCTCGCAAGAGAGCGAACTCCTATTCACTTATAAACACAAAGTCTATGAATGTATTAAATTTTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATACTTCAACCCTCCTCTTTCTTAATGATTGAAGAGGTGTTTGGTTTCTGAGCGCTGCTGGCCTTTACGGTCTAGCTCGTTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGAATTCTAGTCTTCGGATTAGAGCCGGGTTGGGTTAAAGGAAGCTTCTAATCAGAATGTCTACATTTTAAGATTAGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGAC

Morphology

After 3 days at 25°C the cells are ovoidal to spherical  and may occur singly, in pairs, in short chains or small clusters.  There may be a light strawberry-pink ring and light to moderate sediment. 

Name of Depositor NRRL
Chain of Custody
ATCC <-- RRL <-- CBS 17 <-- G. Pollacci
Cross References

Nucleotide (GenBank) : AF189960 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KU729065 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729148 D1/D2 region of 28S rRNA gene

References

Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266

Biswas SK, et al. Molecular phylogenetics of the genus Rhodotorula and related basidiomycetous yeasts inferred from the mitochondrial cytochrome b gene. Int. J. Syst. Evol. Microbiol. 51: 1191-1199, 2001. PubMed: 11411687

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Lodder J, Kreger-van Rij MJW. The yeasts: a taxonomic study. 1st ed.Amsterdam: North-Holland; 1952.

type strain of Rhodotorula rubra (Demme) Lodder

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation