Cryptococcus magnus (Lodder et Kreger-van Rij) Baptist et Kurtzman (ATCC® 20918)

Strain Designations: IFF-8275c  /  Product Format: freeze-dried

Deposited As Cryptococcus albidus (Saito) Skinner
Strain Designations IFF-8275c
Application
Produces lactones
Produces sclareolide
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Preceptrol® no
Comments

This strain was identified as Cryptococcus magnus based on the multigene sequence comparison.  

Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGAAGGATCATTAATGAATTTAGATTGAACCATAGGCGAAAGCCAGTGGTTCTTCTTTCATATCCATAACACCTGTGCACTGTTGGATGCTTGCATCCACTTTTAAACTAAACATTATTGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAAACCCAAGTTTTGGATTTCGATCCATGCTTGAGTTTGGATTTGGATGTTTGCCGGTGATGAACCGACTCATCTTAAAAGTATTAGCTTGGATCTGTCTATATGACTGGTTTGACTTGGCATAATAAGTATTTTGCTGAGGACATCTTCGGATGGCCAGGACCTAGACTACTGTCTGCTAACTAAACCATCACTTTAAGTGCATCTTTGGATGTTACTCATTGTGTAACTTTGACATCTGGCCTCAAATCAAGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGTGGCCTCAGGTCATCCGAGTTGTAATCTATAGAAGTGTTTTCCGTGCTGGCTCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGAACTACCAGTGCTCTGTGATACATTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGCTCTTTGGATTCAGCCGGTTCTGCCGGTGTACTTCCTTTGAGTGGGGTCAACATCAGTTTTGATCGCTGGATAAAGGCTGGAGGAACGTAGTACCCTCGGGTAAACTTATAGCCTCCTGTCACATACAGTGGTTGGGACTGAGGAACGCAGCACGCCTTTATGGCCGGGATTCGTCCACGTACGTGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Name of Depositor International Flavors & Fragrances, Inc.
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Isolation
Soil, Mexico City, Mexico
Cross References

Nucleotide (GenBank) : JQ070166 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070097 ITS including 5.8S rRNA gene

References

Farbood MI, et al. Process for producing diol and lactone and microorganisms capable of same. US Patent 4,970,163 dated Nov 13 1990