Lodderomyces elongisporus (Recca et Mrak) van der Walt, teleomorph (ATCC® 11503)

Strain Designations: 78 [CBS 2605, CCRC 21390, DBVPG 6183, IFO 1676, JCM 1781, NRRL YB-4239]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces elongisporus Recca et Mrak, teleomorph
Strain Designations 78 [CBS 2605, CCRC 21390, DBVPG 6183, IFO 1676, JCM 1781, NRRL YB-4239]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATTTTGAGAATTGTGCTTAACTGCACTTTTCTTATCTACACACGTGTTTTTGTTTTATTCTTAAAACTTGCTTTGGCAGTGGCTGCTTAATTGCTCTGCTGCCAGAGGATAAACTCAACCTAAATTTTTTATTTTAAACTAGTCAACTGATTATATTTATTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGATGAGCAATACGCCAGGTTTGCTTGAAAGTTAGGAGGAGTATTTATAACAATGTATTAGGTCTAACCACTCCATTGTGCTTAATAAAAAGCTCCAATCTATATTTCAAACTTCGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTAGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCTAGATCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGAGAATTGCGTAGGAATGTGGCTCGGCCTCGGTCGAGTGTTATAGCCTTCGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCGC

Name of Depositor JA Recca
Isolation
Concentrated orange juice, California
Cross References

Nucleotide (GenBank) : HQ876050 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ876042 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : HQ876033 18S rRNA gene

Nucleotide (GenBank) : KC507435 EF-1 alpha gene

Nucleotide (GenBank) : KC507404 RPB1 gene

Nucleotide (GenBank) : KC512830 RPB2 gene

References

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624

van der Walt JP. Lodderomyces, a new genus of the Saccharomycetaceae. Antonie van Leeuwenhoek 32: 1-5, 1966. PubMed: 5296604

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation