Trichophyton interdigitale Priestley (ATCC® 9533)

Strain Designations: 640 [Emmons 640, NIH 640, QM 248]  /  Product Format: freeze-dried

Deposited As Trichophyton interdigitale Priestley
Strain Designations 640 [Emmons 640, NIH 640, QM 248]
Application
Efficacy testing
Media testing
Testing antimicrobial agent
Testing disinfectants
Biomedical Research and Development Material
Food testing
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments The strain was re-identified as Trichophyton interdigitale in the Trichophyton mentagrophytes species complex based on the multigene sequence analysis. This change does not affect to its use as quality control strain for standard tests.
Morphology After 3 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, dense, velutinous; reverse orange. Microconidia abundant, hyaline, tear-drop shaped, formed alongside the hyphae. Macroconidia cigar shaped, hyaline, smooth-walled, 2-3 septate.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTACTCCTCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC


beta-tubulin (TUB2) gene

CTAGCTTTCCCCCTGTCCATCACTTCCCCTCTATTTGTGCCCGAAAAACACGACACGGTCTGCACAGGCCAAGAAAGGGGGGGAGGCGAGGGCCACCACACGACCACGTCCCAGCGTGAAGGGGACAGGCTTCGAGTTTCACAATTCTCGCATAGCGAGCTTCGAGCATCAGGCTAACGTGCATTTATCGTATAGGTCCATCTCCAAACCGGCCAATGTGTAAGCTTTGATCGTTCCCTGGTTCGTTCTCAGGTACCCGTTTGAGTTAACAATTGTTCGACATTAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGCATTCATGCGTTGCAGCATAATTGTATATTTCGTGTCGAGTTGTTACTGACTTGGTTTACAGGCAAACCATTGCTGGTGAGCACGGTCTCGATGGATCCGGCCAGTGAGTGATTCTGCAAGAAAAAGTTCCGGTCTTGAGGGACTTGAACGTTGACAACTGGGATTTCTATAGCTACACCGGATCTTCTGACCTCCAATTGGAGCGCATGAATGTCTACTTCAACGAGGTGTGCACGACCAAGACCCTTCCCTTCAGCAGCATACTAACTCATTGGAGGCAAAGGCCTCAAGCAAAAAATACGTTCCCCGTGCGGTTCTTGTTGATCTTGAGCCCGCCGCTCTCGATGCTGTCCGCGCCGGTCCTTTTGGTCAGCTCTTCCGCCCCGATAACGTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGG

Morphology After 3 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, dense, velutinous; reverse orange. Microconidia abundant, hyaline, tear-drop shaped, formed alongside the hyphae. Macroconidia cigar shaped, hyaline, smooth-walled, 2-3 septate.
Name of Depositor CW Emmons
Special Collection ATCC
Isolation
Clinical specimen - human, 1943
Cross References

Nucleotide (GenBank) : KJ606115 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KJ606163 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KJ606211 beta-tubulin (TUB2) gene

References

AOAC International Fungicidal activity of disinfectants. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 955.17.

Quality Control for Commercially Prepared Microbiological Culture Media; Approved Standard - 3rd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M22-A3.

US General Services Administration Disinfectant, general purpose (liquid phenolic type). Washington, DC:US General Services Administration;Commercial Item Description A-A-1438A, 1997

US General Services Administration Disinfectant-detergent, general purpose (phenolic type). Washington, DC:US General Services Administration;Commercial Item Description A-A-1439A, 1998

US General Services Administration Disinfectant-detergent, general purpose (iodophor). Washington, DC:US General Services Administration;Commercial Item Description A-A-1440, 1981

US General Services Administration Disinfectant, general purpose (quaternary ammonium compound). Washington, DC:US General Services Administration;Commercial Item Description A-A-1441B, 2005

US General Services Administration Disinfectant-detergent, general purpose (quaternary ammonium compound). Washington, DC:US General Services Administration;Commercial Item Description A-A-1443A, 1998

AOAC International Germicidal spray products as disinfectants. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 961.02.

human tinea pedis

Standard Quantitative Carrier Test Method to Evaluate the Bactericidal, Fungicidal, Mycobactericidal, and Sporicidal Potencies of Liquid Chemical Microbicides. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2111-05.

Standard Quantitative Disk Carrier Test Method for Determining the Bactericidal, Virucidal, Fungicidal, Mycobactericidal and Sporicidal Activities of Liquid Chemical Germicides. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2197-02.

Standard Practice for Evaluation of Pre-saturated or Impregnated Towelettes for Hard Surface Disinfection . West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2362-04.