Penicillium citrinum Thom (ATCC® 9849)

Strain Designations: [11, CBS 342.61, IFO 6352, IMI 321326, IMI 61272, NRRL 756]  /  Product Format: freeze-dried

Strain Designations [11, CBS 342.61, IFO 6352, IMI 321326, IMI 61272, NRRL 756]
Application
Fungus resistance testing
Fungus resistance testing automotive components
Fungus resistance testing paint
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology Colonies on malt agar at 25°C with slow to moderate growth, velutinous to floccose; mycelium white turning greyish-orange. Conidial masses greyish-turquoise. Conidiophores biverticillate.  Phialides flask-shaped. Conidia spherical to subspherical, smooth-walled or finely roughened, 2.2-3.0 µm diam.
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCCTCGGGGCCCAACCTCCCACCCGTGTTGCCCGAACCTATGTTGCCTCGGCGGGCCCCGCGCCCGCCGACGGCCCCCCTGAACGCTGTCTGAAGTTGCAGTCTGAGACCTATAACGAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCCCCCCGCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTAGTAGGCCCGGCCGGCGCCAGCCGACCCCCAACCTTTAATTATCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAA


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCCTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAACGGCCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGGTGGCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAATTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCACTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCTGGAAGGTAACGCCTCTCGGGGCGTCTTATAGCCAGGGGTGCCATGCGGCCTGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGA

Morphology Colonies on malt agar at 25°C with slow to moderate growth, velutinous to floccose; mycelium white turning greyish-orange. Conidial masses greyish-turquoise. Conidiophores biverticillate.  Phialides flask-shaped. Conidia spherical to subspherical, smooth-walled or finely roughened, 2.2-3.0 µm diam.
Name of Depositor QM
Chain of Custody
ATCC <-- QM <-- QM 1226
Cross References

Nucleotide (GenBank) : JQ070088 ITS including 5.8S rRNA gene

References

Standard method of evaluating the resistance of wood product surfaces to mold growth. Birmingham, AL:American Wood-Preservers' Association;AWPA E24-06, 2006