Cryptococcus neoformans var. grubii Franzot et al. (ATCC® 90112)

Strain Designations: 7588/9.854 MCV 3 [NCCLS 88]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Cryptococcus neoformans (Sanfelice) Vuillemin
Strain Designations 7588/9.854 MCV 3 [NCCLS 88]
Application
susceptibility testing
susceptibility testing antifungal agents
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments

Synergistic effect of combination of fluconazole and flucytosine

This yeast was re-identified as Cryptococcus neoformans var. grubii based on the multigene DNA sequence comparison.

Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

CTGCGGAAGGATCAGTAGAGAATATTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATA

Name of Depositor A Espinel-Ingroff
Isolation
Cerebrospinal fluid, Pennsylvania
References

Espinel-Ingroff A, et al. Collaborative comparison of broth macrodilution and microdilution antifungal susceptibility tests. J Clin Microbiol 30: 3138-3145, 1992. PubMed: 1452697

Nguyen MH, et al. In vitro evaluation of combination of fluconazole and flucytosine against Cryptococcus neoformans var. neoformans. Antimicrob. Agents Chemother. 39: 1691-1695, 1995. PubMed: 7486902

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation