(ATCC® 8554)

Strain Designations: [15, type E, ATCC 34439, CBS 5795, CCRC 21480, DSM 5418, NCYC 1426, NRRL Y-1109, UCD 55-61, VTTC-81112]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations [15, type E, ATCC 34439, CBS 5795, CCRC 21480, DSM 5418, NCYC 1426, NRRL Y-1109, UCD 55-61, VTTC-81112]
Application
Assay of trichothecenes
Bacterial resistance testing adhesives
Degrades glucose D-glucose
Degrades whey permeate
Ferments pentoses
Fungus resistance testing adhesives
Produces acetoin dehydrogenase diacetyl reductase
Produces beta-galactosidase beta-D-galactosidase
Produces biomass
Produces butanediol dehydrogenase acetoin reductase
Produces ethyl alcohol ethanol
Produces glycerol glycerin, glycerine
Produces lactase
Produces single-cell protein SCP
Produces biomass on whey permeate of cheddar cheese
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 3 days cells are globose, ellipsoidal, to cylindrical in single, pairs, or short chains.  Growth is butyrous, glossy, cream-colored to brown.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTATGAATGAATAGATTGCTGGGGGAATCGTCTGAACAAGGCCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTATCAGTTTTCTATTTCTCATCCTAAACACAATGGAGTTCTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAATATTTTGTATTATGAAAAACTATTATACTATAAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTCTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTGGGTCATAGAGACTCATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTTAACCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGC

Morphology After 3 days cells are globose, ellipsoidal, to cylindrical in single, pairs, or short chains.  Growth is butyrous, glossy, cream-colored to brown.
Name of Depositor Lederle Labs.
Chain of Custody
ATCC <-- Lederle Labs. <-- N.C. Laffer 15, type E
Isolation
Meadowgold creamery, USA
References

Schwarz JG, Hang YD. Study of acetoin reductase from Kluyveromyces marxianus. Lett. Appl. Microbiol. 16: 14-16, 1993.

Maleszka R, Schneider H. Fermentation of D-xylose, xylitol, and D-xylulose by yeasts. Can. J. Microbiol. 28: 360-363, 1982. PubMed: 6211222

Madhyastha MS, et al. Optimization of yeast bioassay for trichothecene mycotoxins. J. Food Prot. 57: 490-495, 1994.

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

DeLaney RA, et al. Composition of Saccharomyces fragilis biomass grown on lactose permeate. J. Sci. Food Agric. 26: 1177-1186, 1975.

Schwarz JG, Hang YD. Kluyveromyces marxianus: a potential source of diacetyl reductase. World J. Microbiol. Biotechnol. 10: 385-387, 1994.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation