Cryptococcus albidus (Saito) Skinner (ATCC® 66030)

Strain Designations: AmMS 228  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations AmMS 228
Application
Quality control strain
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments The multigene sequence analysis indicates that the strain is closely related to Cryptococcus albidus var. diffluens (= Cryptococcus diffluens).
Morphology Colonies cream-colored to tan, liquid to mucoid, glossy, with entire margins. Cells globose-ovoid-ellipsoid, reproducing by budding, single, in pairs, or as small clusters.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGATTAACTGTCTGTCGAGCTTGCTCACAGACTTATCATATCCATAACACCTGTGCACTTGTCGGATGGCTTAGTGAAGACCGCAAGGTTGGAACTATCCATCTACTTTACATAACAATTTAGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGAAAACCCTCAACCTTAGATTGGTTAACACCTTTCTTTGGCTTGGATTTGGACGTTTGCCGATGATAAGTCGGCTCGTCTTAAAAGTAATAGCTGGATCTGTCTCGCGACATGGTTTGACTTGGCGTAATAAGTATTTCGCTAAGGACATCTTCGGATGGCCGCGTTGCAAGACTAAAGACCGCTTTCTAATCCATTGATCTTCGGATTAATATTCTTGACATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTAGTAGCCTTCGGCTGCTCGAGTTGTAATCTAGAGAAGTGTTTTCCGTGCCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACCCCCGGTGCTCTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTCTTTGGTATTTATATCATTGAGTGGGGTCAACATCAGTTTTGATCGATGGATAAAGGCACTAGGAAGGTAGCACTCTCGGGTGAACTTATAGCCTAGCGTCATATACATTGATTGGGACTGAGGAACGCAGCATGCCTTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGAC


RNA polymerase II largest subunit (RPB1) gene

CCATATTGAACTGGCGCGGCCCATCTTTCATCCCGGATTCATGAAGACGGTCAAGAAAATCCTCGAGACCGTGTGCACAAACTGCGGCAAGCTCAAGGTCGACAACCGCGATCGCAGCTTGTTCTCGACGCTGAACCGGCTGCAGCCAAAGTACCGGCTCAAGTATGTGCACGAGGCCGCCAAGGGGGTCATGGTGTGCGAAGAGGATGAAGGACCGGACGAGCAGGGAAACTTGCCGCCACCGGGCCACGGAGGCTGCGGTCATCGTCAGCCGCTCATCCGAAGAGAGGGCACCAAGATGTTCGCCGTGTACAAGAAGCAGGAAGAGGACGCCGACGCCAAGAGCCGGAAGGATAACGCCCCGAGCGTCGCCGACAAGCGCAACCTTTCGGCCCAGGAATGCCACAACATTCTCAAGAAAATGTCGGCGGGCGATATGGAAGTGCTCGGTCTTTCGGAAGAGTTTGCGAGGCCGGATTGGATGGTGCTCACCGTGCTGCCCGTTCCGCCCGCGCCCGTCAGGCCGTCCGTCGTTTCCCCGGGTAAAGCCAGCGCACAAGATGACTTGACGTACAAGTTGGCGGAAATCATCAAGGCCAACGCGAGTTTGCAAAAGGCCGAGCAGGAGGGCAGTCCGGCGTACATTATCAATCAGTTTATCGAGTTGCTCCAAGTGAGTCGAGATTTTCACGCTCAAGCGCAGGGCGAATGAGCTGAACGAATCCCCTCTTCAGTACCATGTCGTCACC


elongation factor (EF) 1-alpha gene

AGGCCGACTGTGCCATCCTCATCATCGCCTCCGGTATCGGAGAGTTCGAGGCTGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTTTTGGCCTTCACCCTCGGTGTCCGACAGCTCATCATTGCCATCAACAAGATGGACACCTGCAAGGTTAGTTCGCAGGTCCTGGTCTCTGTACGAATCTTGCTGACCCCTTTTACAGTGGTCCGAAGACCGATACAACGAAATCGTCAAGGAGGCTTCCGGTTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTTCCCTTCGTCCCCATCTCCGGATGGCACGGAGACAACATGTTGGAGGAGTCCACCAACATGCCCTGGTACAAGGGATGGCACAAGGAGTCCAAGGCCGGTGTTGTCAAGGGAAAGACCTTGCTCGAGGCCATCGACGCCATCGAGCCCCCTACCCGACCTTCCGACAAGCCCTTGCGATTGCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGTACGGTGCCCGTCGGTCGAGTCGAGACCGGTGTCATCAAGGCTGGTATGGTCGTCACCTTCGCCCCTGCCAACGTCACCACCGAAGTCAAGTCCGTCGAAATGCACCACGAACAGCTCGCTGAGGGTGTTCCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGACATCCGACGAGGAAACGTCTGCTCCGACTCGAAGAACGACCCCGCTATGGAGTCTGCTTCCTTCAACGCTCAGGTCATTGTCTTGAACCACCCGGGTCAGATCGGTGCCGGCTACTCCCCCGTTTTGGACTGCCACACCGCTCACATTGCCTGCAAGTTCGCTGAGCTCGTTGAGAAGATCGACCGACGAACCGGTAAGGTCATGGAGGCCGCCCCCAAGTTCGTCAAGTCCGGTGA

Morphology Colonies cream-colored to tan, liquid to mucoid, glossy, with entire margins. Cells globose-ovoid-ellipsoid, reproducing by budding, single, in pairs, or as small clusters.
Name of Depositor GJ De Leon
Cross References

Nucleotide (GenBank) : EU266555 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933417 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU933451 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KU933432 elongation factor (EF) 1-alpha gene

Nucleotide (GenBank) : AX109701 Sequence 434 from Patent WO0123604.

Nucleotide (GenBank) : AX109747 Sequence 480 from Patent WO0123604.

References

MicroScan Yeast ID QC Set. Dade/Siemens.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation