Cryptococcus humicola (Daszewska) Golubev (ATCC® 64676)

Strain Designations: LRA 229.03.85  /  Product Format: frozen

Deposited As Candida humicola (Daszewska) Diddens et Lodder
Strain Designations LRA 229.03.85
Application
Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCCTTAGTGGCTAAAAACTATATCCCAAACACCTGTGAACTGTTGAATCGCGTCTTCGGATGTGATTCTTTTACAAACATTGTGTAATGAACGTCATAACATTATAAACAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGATCTCTCAACCAATAGGGTTTCTTATTGGCTTGGATCTGGGTGTTGCCAGCTTTGTCTGGCTCGCCTTAAAGGAGTTAGCGAGTAAAGCTCTGTCGTCTGGCGTAATAAGTTTCGCTGGTGTAGACAGTGGTGGCGCACGCTTATAATCGCCTTCGGGCAATTTTTGACTCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Name of Depositor API System/bioMerieux
Cross References

Nucleotide (GenBank) : GU256753 ITS including 5.8S rRNA gene

References

API ID 32 C. bioMerieux.