Trametes versicolor (Linnaeus : Fries) Lloyd (ATCC® 62976)

Strain Designations: FES 1030 [IFO 30340, Ps 4a]  /  Product Format: frozen

Deposited As Trametes versicolor (Linnaeus : Fries) Pilat, teleomorph
Strain Designations FES 1030 [IFO 30340, Ps 4a]
Application
testing wood preservatives
testing wood for natural resistance to decay
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 12 days on Malt agar medium at 25°C, colony is white, flat, powdery or cottony; reverse uncolored. Clamp connections present.
Medium ATCC® Medium 323: Malt agar medium
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCTTTGCTTCGGCTTAGTGCACTTTCCGGTTGACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGAGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCCTTATGGCTGGGGTTCGCCCACATTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGAC

Morphology After 12 days on Malt agar medium at 25°C, colony is white, flat, powdery or cottony; reverse uncolored. Clamp connections present.
Name of Depositor Y Abe
Chain of Custody
ATCC <-- Y Abe <-- K Aoshima Ps 4a
Isolation
Quercus serrata, Japan
References

Test methods for determining the effectiveness of wood preservatives and their performance requirements. Tokyo, Japan:Japanese Standards Association;JIS K 1571, 2004