Aspergillus niger van Tieghem (ATCC® 6277)

Strain Designations: 5373.16  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 5373.16
Application
Resistance Testing
Fungus resistance testing adhesives
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Sclerotial strain

This fungus was re-identified as Aspergillus niger based on the multigene sequence analysis
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGSGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCSTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTARTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCMATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCWCGGACGCTGGCATAATGGTCGTAAACGAC


beta tubulin gene

TTGCCCTCCCCGTCCCTCGTCCGTCAGGAGACGCGTCGTTGGTTGGCATCTCTTTTGCTCGGGACCCCACCGGTTCTTCGACCAACTCATTCTTGTGCTAACTGCATGTCTTCTTCGCTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCCAATATATGCTTCGGATGATTGCCCCCAAGGGTCTTGATTGGTGTTTGGTGGACTAAACAATATATCATGGTGGTTAGGGTAACCAAATTGGTGCTGCTTTCTGGTACGTATACAACTGCCATTGGATTGGGGATGGAACATCGTCTCTTAGGCTATCTCAGCTTGAGTTCAGATGTTGTCCATTAGGTACATGCTATCGGTCTAAGAACACGTCTAACAATTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTCACACCTCTCAATTGGTCAACAATGGGCAAAGGGTTGGGTCTTCTGACACGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTGAGATCCATCGGACCTTGGCTTTTTCACGACAATATCATCAATGTCCTAATCACTTCAGCAGGCTAGCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG

Name of Depositor C Thom
Chain of Custody
ATCC <-- C Thom <-- O Manns
Isolation
Honduras
References

Adhesives for load-bearing timber structures --- Casein adhesives --- Classification and performance requirements, Annex B. London, UK:British Standards Institution;British Standard BS EN 12436:2002.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation